control grna sequence Search Results


93
R&D Systems recombinant grn protein
a A dual-Glo luciferase assay depicted to test SINE-B1 enhancer activity in ESC and NrESC, as well as siNr1h2 and siNT NrESC samples. Created in BioRender.com. b Genome browser view of Nr1h2-FLAG ChIP-seq (turquoise), H3K27ac ChIP-seq (orange, ESC; purple, NrESC) and RNA-seq signal profile (red) surrounding NrESC up-DEGs ( Scd1 , Abcg1 and Scd2 ). Red-colored boxes and dashed lines indicate the candidate SINE-B1 enhancer regions being tested. c Quantification of the normalized luminescence (normalized to Renilla signal and ESC signal) in three constructs testing for SINE-B1 candidates nearby Scd1 , Abcg1 and Scd2 in ESC and NrESC (top), or siNT and siNr1h2 NrESC (bottom). Two-tailed Welch’s t -test. Data are represented as mean ± s.d.; n = 3 independent assays. d Western blot analysis showing that Kdm1a is only associated with Nr1h2-FLAG in T09-treated Nr1h2-FLAG and Kdm1a-HA overexpressing sample (Nr-FLAG and Kd-HA), compared to GFP control sample (G-FLAG and G-HA). 3 independent experiments were repeated with similar results. e Heatmap of ChIP-seq signal on Nr1h2-FLAG ChIP-seq peaks. The ChIP-seq of Kdm1a was obtained from the GEO database. f Genome browser view of Nr1h2-FLAG ChIP-seq (turquoise), Kdm1a ChIP-seq (blue) and RNA-seq signal profile (red) surrounding NrESC markers ( Grn and Scd1 ). g Expression of Grn , Scd1 and Krt8 in ESC overexpressing EGFP-FLAG or Nr1h2-FLAG under T09 treatment. Expression is relative to Gapdh and normalized to EGFP-FLAG ESC expression. Data are represented as mean ± s.d.; n = 3 technical replicates. h Immunofluorescence of Scd1 in ESC and NrESC. Scale bar, 20 µm. 3 independent experiments were repeated with similar results. i Sequential ChIP-qPCR indicating the increased co-binding of Kdm1a and Nr1h2-FLAG under T09 treatment at Abca1 , Hdac2 , Grn and Scd1 , normalized to EGFP-FLAG control. Regions not bound by Kdm1a and Nr1h2-FLAG were used as negative control. Data are represented as mean ± s.d.; n = 3 technical replicates. j Quantification of blastoid formation efficiency from NrESC treated with <t>recombinant</t> Grn, Igg, Anti-Grn, Igg + T09, or Anti-Grn + T09. One-way ANOVA with Bonferroni correction for multiple comparisons. Data are represented as mean ± s.d.; n = 3 independent assays. k Quantification of blastoid formation efficiency from NrESC treated with T09 and/ or Scd1 inhibitor. One-way ANOVA with Bonferroni correction for multiple comparisons. Data are represented as mean ± s.d.; n = 3 independent assays. l Model schematic showing multifaceted regulatory roles of Nr1h2-specific intrinsic program in NrESC. Created in BioRender.com. Source data are provided as a Source Data file.
Recombinant Grn Protein, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/recombinant grn protein/product/R&D Systems
Average 93 stars, based on 1 article reviews
recombinant grn protein - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

91
Addgene inc lnc pink1 2 5 sgrna 5 gtgctgtggaaagaaaggagggg
a A dual-Glo luciferase assay depicted to test SINE-B1 enhancer activity in ESC and NrESC, as well as siNr1h2 and siNT NrESC samples. Created in BioRender.com. b Genome browser view of Nr1h2-FLAG ChIP-seq (turquoise), H3K27ac ChIP-seq (orange, ESC; purple, NrESC) and RNA-seq signal profile (red) surrounding NrESC up-DEGs ( Scd1 , Abcg1 and Scd2 ). Red-colored boxes and dashed lines indicate the candidate SINE-B1 enhancer regions being tested. c Quantification of the normalized luminescence (normalized to Renilla signal and ESC signal) in three constructs testing for SINE-B1 candidates nearby Scd1 , Abcg1 and Scd2 in ESC and NrESC (top), or siNT and siNr1h2 NrESC (bottom). Two-tailed Welch’s t -test. Data are represented as mean ± s.d.; n = 3 independent assays. d Western blot analysis showing that Kdm1a is only associated with Nr1h2-FLAG in T09-treated Nr1h2-FLAG and Kdm1a-HA overexpressing sample (Nr-FLAG and Kd-HA), compared to GFP control sample (G-FLAG and G-HA). 3 independent experiments were repeated with similar results. e Heatmap of ChIP-seq signal on Nr1h2-FLAG ChIP-seq peaks. The ChIP-seq of Kdm1a was obtained from the GEO database. f Genome browser view of Nr1h2-FLAG ChIP-seq (turquoise), Kdm1a ChIP-seq (blue) and RNA-seq signal profile (red) surrounding NrESC markers ( Grn and Scd1 ). g Expression of Grn , Scd1 and Krt8 in ESC overexpressing EGFP-FLAG or Nr1h2-FLAG under T09 treatment. Expression is relative to Gapdh and normalized to EGFP-FLAG ESC expression. Data are represented as mean ± s.d.; n = 3 technical replicates. h Immunofluorescence of Scd1 in ESC and NrESC. Scale bar, 20 µm. 3 independent experiments were repeated with similar results. i Sequential ChIP-qPCR indicating the increased co-binding of Kdm1a and Nr1h2-FLAG under T09 treatment at Abca1 , Hdac2 , Grn and Scd1 , normalized to EGFP-FLAG control. Regions not bound by Kdm1a and Nr1h2-FLAG were used as negative control. Data are represented as mean ± s.d.; n = 3 technical replicates. j Quantification of blastoid formation efficiency from NrESC treated with <t>recombinant</t> Grn, Igg, Anti-Grn, Igg + T09, or Anti-Grn + T09. One-way ANOVA with Bonferroni correction for multiple comparisons. Data are represented as mean ± s.d.; n = 3 independent assays. k Quantification of blastoid formation efficiency from NrESC treated with T09 and/ or Scd1 inhibitor. One-way ANOVA with Bonferroni correction for multiple comparisons. Data are represented as mean ± s.d.; n = 3 independent assays. l Model schematic showing multifaceted regulatory roles of Nr1h2-specific intrinsic program in NrESC. Created in BioRender.com. Source data are provided as a Source Data file.
Lnc Pink1 2 5 Sgrna 5 Gtgctgtggaaagaaaggagggg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lnc pink1 2 5 sgrna 5 gtgctgtggaaagaaaggagggg/product/Addgene inc
Average 91 stars, based on 1 article reviews
lnc pink1 2 5 sgrna 5 gtgctgtggaaagaaaggagggg - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier

90
Millipore lacz nontargeting control guide
a A dual-Glo luciferase assay depicted to test SINE-B1 enhancer activity in ESC and NrESC, as well as siNr1h2 and siNT NrESC samples. Created in BioRender.com. b Genome browser view of Nr1h2-FLAG ChIP-seq (turquoise), H3K27ac ChIP-seq (orange, ESC; purple, NrESC) and RNA-seq signal profile (red) surrounding NrESC up-DEGs ( Scd1 , Abcg1 and Scd2 ). Red-colored boxes and dashed lines indicate the candidate SINE-B1 enhancer regions being tested. c Quantification of the normalized luminescence (normalized to Renilla signal and ESC signal) in three constructs testing for SINE-B1 candidates nearby Scd1 , Abcg1 and Scd2 in ESC and NrESC (top), or siNT and siNr1h2 NrESC (bottom). Two-tailed Welch’s t -test. Data are represented as mean ± s.d.; n = 3 independent assays. d Western blot analysis showing that Kdm1a is only associated with Nr1h2-FLAG in T09-treated Nr1h2-FLAG and Kdm1a-HA overexpressing sample (Nr-FLAG and Kd-HA), compared to GFP control sample (G-FLAG and G-HA). 3 independent experiments were repeated with similar results. e Heatmap of ChIP-seq signal on Nr1h2-FLAG ChIP-seq peaks. The ChIP-seq of Kdm1a was obtained from the GEO database. f Genome browser view of Nr1h2-FLAG ChIP-seq (turquoise), Kdm1a ChIP-seq (blue) and RNA-seq signal profile (red) surrounding NrESC markers ( Grn and Scd1 ). g Expression of Grn , Scd1 and Krt8 in ESC overexpressing EGFP-FLAG or Nr1h2-FLAG under T09 treatment. Expression is relative to Gapdh and normalized to EGFP-FLAG ESC expression. Data are represented as mean ± s.d.; n = 3 technical replicates. h Immunofluorescence of Scd1 in ESC and NrESC. Scale bar, 20 µm. 3 independent experiments were repeated with similar results. i Sequential ChIP-qPCR indicating the increased co-binding of Kdm1a and Nr1h2-FLAG under T09 treatment at Abca1 , Hdac2 , Grn and Scd1 , normalized to EGFP-FLAG control. Regions not bound by Kdm1a and Nr1h2-FLAG were used as negative control. Data are represented as mean ± s.d.; n = 3 technical replicates. j Quantification of blastoid formation efficiency from NrESC treated with <t>recombinant</t> Grn, Igg, Anti-Grn, Igg + T09, or Anti-Grn + T09. One-way ANOVA with Bonferroni correction for multiple comparisons. Data are represented as mean ± s.d.; n = 3 independent assays. k Quantification of blastoid formation efficiency from NrESC treated with T09 and/ or Scd1 inhibitor. One-way ANOVA with Bonferroni correction for multiple comparisons. Data are represented as mean ± s.d.; n = 3 independent assays. l Model schematic showing multifaceted regulatory roles of Nr1h2-specific intrinsic program in NrESC. Created in BioRender.com. Source data are provided as a Source Data file.
Lacz Nontargeting Control Guide, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lacz nontargeting control guide/product/Millipore
Average 90 stars, based on 1 article reviews
lacz nontargeting control guide - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
GenScript corporation rnase1 crispr guide rna (target sequence: tgccaagggctcatgcacga)
a A dual-Glo luciferase assay depicted to test SINE-B1 enhancer activity in ESC and NrESC, as well as siNr1h2 and siNT NrESC samples. Created in BioRender.com. b Genome browser view of Nr1h2-FLAG ChIP-seq (turquoise), H3K27ac ChIP-seq (orange, ESC; purple, NrESC) and RNA-seq signal profile (red) surrounding NrESC up-DEGs ( Scd1 , Abcg1 and Scd2 ). Red-colored boxes and dashed lines indicate the candidate SINE-B1 enhancer regions being tested. c Quantification of the normalized luminescence (normalized to Renilla signal and ESC signal) in three constructs testing for SINE-B1 candidates nearby Scd1 , Abcg1 and Scd2 in ESC and NrESC (top), or siNT and siNr1h2 NrESC (bottom). Two-tailed Welch’s t -test. Data are represented as mean ± s.d.; n = 3 independent assays. d Western blot analysis showing that Kdm1a is only associated with Nr1h2-FLAG in T09-treated Nr1h2-FLAG and Kdm1a-HA overexpressing sample (Nr-FLAG and Kd-HA), compared to GFP control sample (G-FLAG and G-HA). 3 independent experiments were repeated with similar results. e Heatmap of ChIP-seq signal on Nr1h2-FLAG ChIP-seq peaks. The ChIP-seq of Kdm1a was obtained from the GEO database. f Genome browser view of Nr1h2-FLAG ChIP-seq (turquoise), Kdm1a ChIP-seq (blue) and RNA-seq signal profile (red) surrounding NrESC markers ( Grn and Scd1 ). g Expression of Grn , Scd1 and Krt8 in ESC overexpressing EGFP-FLAG or Nr1h2-FLAG under T09 treatment. Expression is relative to Gapdh and normalized to EGFP-FLAG ESC expression. Data are represented as mean ± s.d.; n = 3 technical replicates. h Immunofluorescence of Scd1 in ESC and NrESC. Scale bar, 20 µm. 3 independent experiments were repeated with similar results. i Sequential ChIP-qPCR indicating the increased co-binding of Kdm1a and Nr1h2-FLAG under T09 treatment at Abca1 , Hdac2 , Grn and Scd1 , normalized to EGFP-FLAG control. Regions not bound by Kdm1a and Nr1h2-FLAG were used as negative control. Data are represented as mean ± s.d.; n = 3 technical replicates. j Quantification of blastoid formation efficiency from NrESC treated with <t>recombinant</t> Grn, Igg, Anti-Grn, Igg + T09, or Anti-Grn + T09. One-way ANOVA with Bonferroni correction for multiple comparisons. Data are represented as mean ± s.d.; n = 3 independent assays. k Quantification of blastoid formation efficiency from NrESC treated with T09 and/ or Scd1 inhibitor. One-way ANOVA with Bonferroni correction for multiple comparisons. Data are represented as mean ± s.d.; n = 3 independent assays. l Model schematic showing multifaceted regulatory roles of Nr1h2-specific intrinsic program in NrESC. Created in BioRender.com. Source data are provided as a Source Data file.
Rnase1 Crispr Guide Rna (Target Sequence: Tgccaagggctcatgcacga), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rnase1 crispr guide rna (target sequence: tgccaagggctcatgcacga)/product/GenScript corporation
Average 90 stars, based on 1 article reviews
rnase1 crispr guide rna (target sequence: tgccaagggctcatgcacga) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

91
Santa Cruz Biotechnology px458 ctnna1 grna
( a ) Heatmaps show how varying the cancer cell proteolysis value (x axis) impacts on different metrics in the absence of fibroblasts. WT indicates the ‘wild-type’ value based on experimental parameterisation using A431 cancer cells. ( b ) Heatmaps show the differential values resulting from the inclusion of fibroblasts (effectively a comparison of and Figure 3—figure supplement 1a). Red indicates an increase when fibroblasts are present, dark blue a reduction when in the presence of fibroblasts. ( c ) Images show simulation output initiated with a spheroid, no fibroblasts, a uniform chemotactic cue, and varying cancer cell proteolysis. Left panel – day 7output in the absence of permissive track, right panel – day 5 output in the presence of permissive track. ( d ) Heatmaps show how varying the distribution of extracellular matrix (ECM) density in organotypic simulations impacts on different metrics when fibroblasts are included in all simulations. Parametrisation and colourmap as in ( a ). ‘Aligned’ refers to alternating tracks of high and low ECM density parallel to direction of invasion. ‘Chessboard’ refers to three-dimensional (3D) chessboard distribution of high and low ECM density values. ( e ) Heatmaps show how varying the cancer cell proteolysis value (x axis) impacts on different metrics when cancer-cell proliferation rate is halved, and fibroblasts are included in all simulations. Parametrisation and colourmap as in ( a ). ( f ) Western blots of MMP14, alpha-catenin, vimentin, fibronectin, and β-actin in A431 cells engineered using Crispr/Cas9 to delete MMP14 or <t>CTNNA1,</t> or to over-express MMP14. ( g ) Images show F-actin (magenta) and degraded collagen I represented by fluorescence of DQ collagen I (green) in 3D culture of A431 cells genetically engineered as indicated. ( h ) Plot shows the quantification of strand width in spheroid invasion assay of A431 WT or MMP14 over-expressing cells, which are pre-treated with mitomycin C. Unpaired t-test was performed. Error bars indicate 95% confidence intervals, one dot represents one strand. For comparison, light blue lines show the same metrics in the absence of mitomycin C (data from ). Figure 3—figure supplement 1—source data 1. Quantification of invading strand width in A431 WT and MMP14 OE cells pretreated with mitomycin C. Figure 3—figure supplement 1—source data 2. Uncropped western blot images of WT, MMP14 KO, MMP14 OE, CTNNA1 KO, MMP14 KO/CTNNA1 KO, and MMP14 OE/CTNNA1 KO A431 lysates stained for MMP14, alpha-catenin, vimentin, fibronectin, or β-actin.
Px458 Ctnna1 Grna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/px458 ctnna1 grna/product/Santa Cruz Biotechnology
Average 91 stars, based on 1 article reviews
px458 ctnna1 grna - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier

96
Addgene inc cas9 grna vector pspcas9 bb 2a gfp
(A) Flow cytometry histogram showing surface staining of Galectin-1 in naive (gray), memory (blue), and PCs (red) in human peripheral blood B cells (left panel). Isotype control is shown by gray-dotted histogram. Graph shows fold increase in surface Galectin-1 staining (MFI) relative to naive B cells (n = 4). Contour plot depicts CD45 activity versus Galectin-1 surface staining in B cells (blue) and PCs (CD138 hi CD38 hi ) (red) backgated to CD45 activity hi Galectin-1 hi cells (right panel). (B) Histograms show CD45 activity (left panel), Galectin-1 staining (middle panel), and MEM-55 staining (right panel) in CTR- or NA-treated B cells. Graphs show fold increase in MFI of CD45 phosphatase activity (left lower panel) and Galectin-1 staining (right lower panel) relative to CTR-treated B cells (n = 6). (C) Upper panels: Dot plots show expression of IRF4 and BLIMP1 in naive B cells and MBCs differentiated toward ASCs in the presence of 10 and 100 µM OTX008 or VEH. Graph shows % IRF4 + BLIMP1 + B cells in MBC cultures. Lower panels: Galectin-1 surface expression (left panel) and CD45 phosphatase activity (right panel) in VEH-treated (blue histogram) and OTX-treated (blue dotted histogram) MBCs. Graphs show MFI values of Galectin-1 staining (left) and CD45 activity (right) (n = 5). (D) Flow cytometry dot plots show CD45 activity versus Galectin-1 surface staining in the presence of medium or rhGAL-1 (left panels). Histogram shows CD45 phosphatase activity of Galectin-1 hi B cells with rhGAL1 (blue) and total B cells (gray) (middle panel). Graph shows MFI values of CD45 activity in total B cells (gray histogram) and GAL-1 hi (blue open histogram) B cells (right panel) (n = 6). (E) Representative localization of Galectin-1 relative to pSyk, pCAP-SP1, and CD45 in human B cells. The panels (left) present signals from the individual fluorescence detectors, and the center image is a merge of all four channels. The graph (right) shows the average (z axis) fluorescence intensity for each (x axis) pixel number in the indicated area (below graph and dotted area on center figure). (F) CoIP of CD45 of B cell lysates and immunoblotted with anti-CD45 (left) or anti-Galectin-1 (right). (G) Flow cytometry histogram showing CD45 phosphatase activity in gated live Raji B cells with <t>CRISPR-Cas9</t> knockdown of CD45 (blue), Galectin-1 (green), and wild-type (red). Related to and . *p < 0.05, **p < 0.01.
Cas9 Grna Vector Pspcas9 Bb 2a Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cas9 grna vector pspcas9 bb 2a gfp/product/Addgene inc
Average 96 stars, based on 1 article reviews
cas9 grna vector pspcas9 bb 2a gfp - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

90
Addgene inc negative control grnas
(a) Schematic diagram of the selection of T2D and FG-associated variants used in the assignments of 3D targets analysis (see also Methods , Extended Data 1 and Supplementary Table 1 ). (b) Map of the CDC123/CAMK1D locus (an alternative representation of the same region depicted in ) showing pcHi-C high-confidence interactions (pink) and imputed assignments (grey). (c) Luciferase assay in the human β cell line EndoC-βH3 shows allele-dependent activity for the rs11257655-enhancer. Data are presented as mean ± s.d. Two independent experiments were performed in quadruplicates. ** P <0.01, two-tailed Student’s t-test (d,e) Analysis of OPTN and CAMK1D mRNA after CRISPR <t>inhibition</t> <t>(CRISPRi)</t> of the rs11257655-enhancer in EndoC-βH3 cells (d) and (e) HepG2 cells. Bars show average values of three <t>guide</t> <t>RNAs</t> targeting either the rs11257655 enhancer, or the OPTN transcriptional start site as control. Data are presented as mean ± s.d. Two independent experiments were performed in triplicates. Data shown was normalized by RPLP0 and is shown relative to the mean levels of the negative controls. ** P <0.01, *** P <0.001, two-tailed Student’s t-test. (f) Analysis of OPTN and CAMK1D mRNA after CRISPR activation (CRISPRa) in EndoC-βH3 cells. Analysis as in panel D. (g) Analysis of the T2D-associated locus TCF7L2 . Virtual 4C maps centered on all genes in this locus show that the T2D-associated regulatory variant rs7903146 connects with TCF7L2 through moderate-confidence interactions and an imputed assignment, but shows no evidence for interactions with other genes. The HindIII fragment that contains the enhancer is highlighted in yellow. The bottom panel shows that this enhancer shows an unusually strong occupancy by Mediator, in addition to islet-enriched transcription factors. (h) Analysis of active islet genes in this locus, TCF7L2, VT11A, HABP2, ACSL5 in EndoC-βH3 cells after deletion of either the rs7903146-enhancer or a control region in the same locus (see ). Deletions were tested with 2 different guide RNA pairs. Data are presented as mean ± s.d. Two independent experiments were performed in triplicates. Data was normalized by RPLP0 and is shown relative to the mean levels of the negative control deletions. *** P <0.001, two-tailed Student’s t-test. (i) Analysis of TCF7L2, VT11A, HABP2 mRNA in EndoC-βH3 cells after CRISPR activation (CRISPRa) of this enhancer. The analysis was carried out as in panel H. *** P <0.001, two-tailed Student’s t-test.
Negative Control Grnas, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/negative control grnas/product/Addgene inc
Average 90 stars, based on 1 article reviews
negative control grnas - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

94
Addgene inc human keap1 single guide rna sgrna target sequences
( A ) Lysates of HEK293T cells expressing FLAG-tagged human KLHL proteins were subjected to immunoprecipitation (IP) with antibodies to FLAG, and the resulting precipitates as well as the original lysates (Input) were subjected to immunoblot analysis with the indicated antibodies (α-). GAPDH was examined as a loading control. ( B ) Lysates of HEK293T cells expressing FLAG-tagged human KLHL3 or <t>Keap1</t> together with HA-tagged human Cul3 were subjected to immunoprecipitation with antibodies to FLAG, and the resulting precipitates as well as the original lysates were subjected to immunoblot analysis with the indicated antibodies. GAPDH was examined as a loading control. ( C ) Fifty-three BTB proteins previously found to interact with Cul3 in HEK293T cells . Z and NWD scores were obtained from CompPASS analysis . Cul3 interactants in the BioPlex 3.0 database are shown in green, with others shown in gray. ( D and E ) Representative ITC titration curves for interaction between human Cul3(N) and either human KLHL3(N) (D) or human Keap1(N) (E) as well as domain organization of the protein fragments. Baseline-corrected differential power (DP) versus time as well as the normalized binding curve, with integrated changes in enthalpy (Δ H ) plotted against molar ratio, are shown. Each experiment was performed independently at least twice. ( F ) Dissociation constants for Cullins and the indicated receptors. Values other than those for Keap1 and KLHL3 were obtained from previous studies ( , , , – ). n.d., not detected.
Human Keap1 Single Guide Rna Sgrna Target Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human keap1 single guide rna sgrna target sequences/product/Addgene inc
Average 94 stars, based on 1 article reviews
human keap1 single guide rna sgrna target sequences - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

90
Lexogen GmbH sirv-set 4 lexogen catalog number 141
( A ) Lysates of HEK293T cells expressing FLAG-tagged human KLHL proteins were subjected to immunoprecipitation (IP) with antibodies to FLAG, and the resulting precipitates as well as the original lysates (Input) were subjected to immunoblot analysis with the indicated antibodies (α-). GAPDH was examined as a loading control. ( B ) Lysates of HEK293T cells expressing FLAG-tagged human KLHL3 or <t>Keap1</t> together with HA-tagged human Cul3 were subjected to immunoprecipitation with antibodies to FLAG, and the resulting precipitates as well as the original lysates were subjected to immunoblot analysis with the indicated antibodies. GAPDH was examined as a loading control. ( C ) Fifty-three BTB proteins previously found to interact with Cul3 in HEK293T cells . Z and NWD scores were obtained from CompPASS analysis . Cul3 interactants in the BioPlex 3.0 database are shown in green, with others shown in gray. ( D and E ) Representative ITC titration curves for interaction between human Cul3(N) and either human KLHL3(N) (D) or human Keap1(N) (E) as well as domain organization of the protein fragments. Baseline-corrected differential power (DP) versus time as well as the normalized binding curve, with integrated changes in enthalpy (Δ H ) plotted against molar ratio, are shown. Each experiment was performed independently at least twice. ( F ) Dissociation constants for Cullins and the indicated receptors. Values other than those for Keap1 and KLHL3 were obtained from previous studies ( , , , – ). n.d., not detected.
Sirv Set 4 Lexogen Catalog Number 141, supplied by Lexogen GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sirv-set 4 lexogen catalog number 141/product/Lexogen GmbH
Average 90 stars, based on 1 article reviews
sirv-set 4 lexogen catalog number 141 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

96
Addgene inc grna cloning vector
<t>S1P</t> is required for hantavirus infection. (A) The S1P gene was knocked out in U2OS cells by using the CRISPR/Cas9 system. (Top) WT S1P gene sequence aligned with the sequences of both of the alleles in the S1P knockout (S1P-#1) cell clone. The <t>gRNA</t> target sequence is marked in red. The protospacer-adjacent motif (PAM) sequence of the gRNA target site is underlined. (Lower left) RT-PCR results for WT and S1P knockout (S1P-#1) cells using gRNA target site-specific primers. Human NPC1-specific primers were used as a control. (Lower right) S1P protein expression by anti-Flag immunostaining in S1P-#1 cells stably expressing Flag-tagged S1P. (B) WT and S1P knockout (S1P-#1) and S1P-reconstituted (S1P knockout cells stably expressing Flag-tagged S1P) U2OS cells were exposed to the indicated rVSVs at a multiplicity of infection (MOI) of 0.1 to 0.2 IU per cell. Infected (eGFP-positive) cells were visualized by fluorescence microscopy at 12 to 16 h postinfection. (C, left) Infected cells from the experiment in panel B were enumerated and normalized to infection in WT cells ( n = 6; two independent experiments). (Right) WT, S1P knockout, and S1P-reconstituted cells were exposed to authentic ANDV at an MOI of 0.1 to 0.2 PFU per cell. Infection was scored at 72 h postinfection by enumerating viral-antigen-positive cells and was normalized to infection in WT U2OS cells.
Grna Cloning Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/grna cloning vector/product/Addgene inc
Average 96 stars, based on 1 article reviews
grna cloning vector - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

93
Addgene inc guide rna grna sequences targeting brd4
( a ) Gene set enrichment plot showing that genes associated with high H3K9ac and H3K27ac are enriched for two independently defined pluripotency gene sets: Muller Plurinet (genes involved in the protein-protein network shared by diverse pluripotent cell types ) and Wong ESC Core (genes coordinately upregulated in mouse and human ESCs ). Data are derived from a single ChIP-Seq experiment . P values are calculated based on 1000 permutations by the GSEA algorithm and was not adjusted for multiple comparisons. ( b ) 2i increases acetylation at key pluripotency genes. H3K27ac (left) and H3K9ac (right) at enhancer (enh) or promoters of indicated genes as assessed by ChIP-qPCR. ( c ) ChIP-seq meta profile for <t>Brd4</t> binding in ESCs cultured in S/L or S/L+2i. The metaprofile is centered on the midpoint of all Brd4 ChIP-seq peaks. ( d ) Brd4 ChIP-qPCR illustrating Brd4 binding in ESCs cultured in S/L (left) or S/L+2i (right) treated with DMSO (vehicle) or 500 nM JQ1 for 24 h. ( b,d ) Bars represent mean of n=3 technical replicates from one IP.
Guide Rna Grna Sequences Targeting Brd4, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/guide rna grna sequences targeting brd4/product/Addgene inc
Average 93 stars, based on 1 article reviews
guide rna grna sequences targeting brd4 - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

94
Addgene inc human talin single guide rnas sgrnas
<t>Talin</t> binding to the β7 cytoplasmic domain activates integrin α4β7. (A) Expression of talin and β7 in parental or talin KO β7-expressing Jurkat T cells. Top: Total expression by Western blot. Bottom: Surface expression by flow cytometry. The filled histograms represent untransfected Jurkat cells, whereas open histograms represent β7-expressing Jurkat cells or talin KO cells. (B) Binding of soluble MAdCAM-1 to β7 expressing Jurkat T cells or talin KO cells. PMA (100 nM) markedly increased binding to parental but not talin KO cells. Mn 2+ (0.5 mM) stimulated binding to both cell types. Stimulated cells were compared with resting (None) for each cell line using one-way ANOVA. (C) Adhesion of β7-expressing Jurkat T cells or Jurkat-talin KO cells to MAdCAM-1 substrate in the presence or absence of PMA (100 nM) under a wall shear stress of 2 dyn/cm 2 . Nontransfected Jurkat T cells (Jurkat) provided a negative control. Jurkat-β7-Talin KO or Jurkat were compared with the Jurkat-β7 for each condition using one-way ANOVA. (D) Structural model of the talin F3 domain in complex with integrin β7 tail (Arg 728 to Thr 766 ). Talin F3 domain is shown by a surface representation and colored by charge. A ribbon diagram of the docked β7 tail is highlighted in red. β7-Leu 758 and -Tyr 759 in the NPLY motif are shown as light blue–colored stick figures. (E) Soluble MAdCAM-1 binding to 293T cells transfected with WT or mutant α4β7 with or without THD cotransfection. Mn 2+ (0.5 mM) was used as a positive control for integrin activation. Nontransfected 293T cells (MOCK) provided a negative control. Mutant integrins were compared with the WT for each condition using one-way ANOVA. (F) Adhesion of 293T cells transfected with WT or mutant α4β7 with or without THD cotransfection on MAdCAM-1 under a wall shear stress of 2 dyn/cm 2 . Nontransfected 293T cells (MOCK) provided a negative control. Mutant integrins were compared with the WT for each condition using one-way ANOVA. (G) Binding of soluble MAdCAM-1 to 293T-α4β7 cells transfected with EGFP vector, EGFP-THD, EGFP-THD(L325R), or EGFP-THD(W359A). THD-stimulated cells were compared with vector control (α4β7 + EGFP vector) for each cell line using two-way ANOVA. MFI, mean fluorescent intensity. (H) Adhesion of 293T-α4β7 cells transfected with EGFP vector, EGFP-THD, EGFP-THD(L325R), or EGFP-THD(W359A) on MAdCAM-1 under a wall shear stress of 2 dyn/cm 2 . 293T cells transfected with THD only and nontransfected 293T cells (MOCK) were used as negative controls. THD-stimulated cells were compared with vector control (α4β7 + EGFP vector) for each cell line using one-way ANOVA. Error bars show means ± SD. n = 5. NS, P > 0.05; *, 0.01 < P < 0.05; **, 0.001 < P < 0.01; ***, P < 0.001.
Human Talin Single Guide Rnas Sgrnas, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human talin single guide rnas sgrnas/product/Addgene inc
Average 94 stars, based on 1 article reviews
human talin single guide rnas sgrnas - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

Image Search Results


a A dual-Glo luciferase assay depicted to test SINE-B1 enhancer activity in ESC and NrESC, as well as siNr1h2 and siNT NrESC samples. Created in BioRender.com. b Genome browser view of Nr1h2-FLAG ChIP-seq (turquoise), H3K27ac ChIP-seq (orange, ESC; purple, NrESC) and RNA-seq signal profile (red) surrounding NrESC up-DEGs ( Scd1 , Abcg1 and Scd2 ). Red-colored boxes and dashed lines indicate the candidate SINE-B1 enhancer regions being tested. c Quantification of the normalized luminescence (normalized to Renilla signal and ESC signal) in three constructs testing for SINE-B1 candidates nearby Scd1 , Abcg1 and Scd2 in ESC and NrESC (top), or siNT and siNr1h2 NrESC (bottom). Two-tailed Welch’s t -test. Data are represented as mean ± s.d.; n = 3 independent assays. d Western blot analysis showing that Kdm1a is only associated with Nr1h2-FLAG in T09-treated Nr1h2-FLAG and Kdm1a-HA overexpressing sample (Nr-FLAG and Kd-HA), compared to GFP control sample (G-FLAG and G-HA). 3 independent experiments were repeated with similar results. e Heatmap of ChIP-seq signal on Nr1h2-FLAG ChIP-seq peaks. The ChIP-seq of Kdm1a was obtained from the GEO database. f Genome browser view of Nr1h2-FLAG ChIP-seq (turquoise), Kdm1a ChIP-seq (blue) and RNA-seq signal profile (red) surrounding NrESC markers ( Grn and Scd1 ). g Expression of Grn , Scd1 and Krt8 in ESC overexpressing EGFP-FLAG or Nr1h2-FLAG under T09 treatment. Expression is relative to Gapdh and normalized to EGFP-FLAG ESC expression. Data are represented as mean ± s.d.; n = 3 technical replicates. h Immunofluorescence of Scd1 in ESC and NrESC. Scale bar, 20 µm. 3 independent experiments were repeated with similar results. i Sequential ChIP-qPCR indicating the increased co-binding of Kdm1a and Nr1h2-FLAG under T09 treatment at Abca1 , Hdac2 , Grn and Scd1 , normalized to EGFP-FLAG control. Regions not bound by Kdm1a and Nr1h2-FLAG were used as negative control. Data are represented as mean ± s.d.; n = 3 technical replicates. j Quantification of blastoid formation efficiency from NrESC treated with recombinant Grn, Igg, Anti-Grn, Igg + T09, or Anti-Grn + T09. One-way ANOVA with Bonferroni correction for multiple comparisons. Data are represented as mean ± s.d.; n = 3 independent assays. k Quantification of blastoid formation efficiency from NrESC treated with T09 and/ or Scd1 inhibitor. One-way ANOVA with Bonferroni correction for multiple comparisons. Data are represented as mean ± s.d.; n = 3 independent assays. l Model schematic showing multifaceted regulatory roles of Nr1h2-specific intrinsic program in NrESC. Created in BioRender.com. Source data are provided as a Source Data file.

Journal: Nature Communications

Article Title: Nuclear receptor-SINE B1 network modulates expanded pluripotency in blastoids and blastocysts

doi: 10.1038/s41467-024-54381-0

Figure Lengend Snippet: a A dual-Glo luciferase assay depicted to test SINE-B1 enhancer activity in ESC and NrESC, as well as siNr1h2 and siNT NrESC samples. Created in BioRender.com. b Genome browser view of Nr1h2-FLAG ChIP-seq (turquoise), H3K27ac ChIP-seq (orange, ESC; purple, NrESC) and RNA-seq signal profile (red) surrounding NrESC up-DEGs ( Scd1 , Abcg1 and Scd2 ). Red-colored boxes and dashed lines indicate the candidate SINE-B1 enhancer regions being tested. c Quantification of the normalized luminescence (normalized to Renilla signal and ESC signal) in three constructs testing for SINE-B1 candidates nearby Scd1 , Abcg1 and Scd2 in ESC and NrESC (top), or siNT and siNr1h2 NrESC (bottom). Two-tailed Welch’s t -test. Data are represented as mean ± s.d.; n = 3 independent assays. d Western blot analysis showing that Kdm1a is only associated with Nr1h2-FLAG in T09-treated Nr1h2-FLAG and Kdm1a-HA overexpressing sample (Nr-FLAG and Kd-HA), compared to GFP control sample (G-FLAG and G-HA). 3 independent experiments were repeated with similar results. e Heatmap of ChIP-seq signal on Nr1h2-FLAG ChIP-seq peaks. The ChIP-seq of Kdm1a was obtained from the GEO database. f Genome browser view of Nr1h2-FLAG ChIP-seq (turquoise), Kdm1a ChIP-seq (blue) and RNA-seq signal profile (red) surrounding NrESC markers ( Grn and Scd1 ). g Expression of Grn , Scd1 and Krt8 in ESC overexpressing EGFP-FLAG or Nr1h2-FLAG under T09 treatment. Expression is relative to Gapdh and normalized to EGFP-FLAG ESC expression. Data are represented as mean ± s.d.; n = 3 technical replicates. h Immunofluorescence of Scd1 in ESC and NrESC. Scale bar, 20 µm. 3 independent experiments were repeated with similar results. i Sequential ChIP-qPCR indicating the increased co-binding of Kdm1a and Nr1h2-FLAG under T09 treatment at Abca1 , Hdac2 , Grn and Scd1 , normalized to EGFP-FLAG control. Regions not bound by Kdm1a and Nr1h2-FLAG were used as negative control. Data are represented as mean ± s.d.; n = 3 technical replicates. j Quantification of blastoid formation efficiency from NrESC treated with recombinant Grn, Igg, Anti-Grn, Igg + T09, or Anti-Grn + T09. One-way ANOVA with Bonferroni correction for multiple comparisons. Data are represented as mean ± s.d.; n = 3 independent assays. k Quantification of blastoid formation efficiency from NrESC treated with T09 and/ or Scd1 inhibitor. One-way ANOVA with Bonferroni correction for multiple comparisons. Data are represented as mean ± s.d.; n = 3 independent assays. l Model schematic showing multifaceted regulatory roles of Nr1h2-specific intrinsic program in NrESC. Created in BioRender.com. Source data are provided as a Source Data file.

Article Snippet: For blastoid experiments involving recombinant Grn protein or Grn neutralizing antibody, 5 µg/mL of Recombinant Mouse Progranulin Protein (R&D Systems, 2557-PG-050), Mouse Progranulin Antibody (R&D Systems, MAB2557) or Rat IgG2A Isotype Control (R&D Systems, MAB006) was added to the complete blastoid medium.

Techniques: Luciferase, Activity Assay, ChIP-sequencing, RNA Sequencing Assay, Construct, Two Tailed Test, Western Blot, Control, Expressing, Immunofluorescence, Binding Assay, Negative Control, Recombinant

( a ) Heatmaps show how varying the cancer cell proteolysis value (x axis) impacts on different metrics in the absence of fibroblasts. WT indicates the ‘wild-type’ value based on experimental parameterisation using A431 cancer cells. ( b ) Heatmaps show the differential values resulting from the inclusion of fibroblasts (effectively a comparison of and Figure 3—figure supplement 1a). Red indicates an increase when fibroblasts are present, dark blue a reduction when in the presence of fibroblasts. ( c ) Images show simulation output initiated with a spheroid, no fibroblasts, a uniform chemotactic cue, and varying cancer cell proteolysis. Left panel – day 7output in the absence of permissive track, right panel – day 5 output in the presence of permissive track. ( d ) Heatmaps show how varying the distribution of extracellular matrix (ECM) density in organotypic simulations impacts on different metrics when fibroblasts are included in all simulations. Parametrisation and colourmap as in ( a ). ‘Aligned’ refers to alternating tracks of high and low ECM density parallel to direction of invasion. ‘Chessboard’ refers to three-dimensional (3D) chessboard distribution of high and low ECM density values. ( e ) Heatmaps show how varying the cancer cell proteolysis value (x axis) impacts on different metrics when cancer-cell proliferation rate is halved, and fibroblasts are included in all simulations. Parametrisation and colourmap as in ( a ). ( f ) Western blots of MMP14, alpha-catenin, vimentin, fibronectin, and β-actin in A431 cells engineered using Crispr/Cas9 to delete MMP14 or CTNNA1, or to over-express MMP14. ( g ) Images show F-actin (magenta) and degraded collagen I represented by fluorescence of DQ collagen I (green) in 3D culture of A431 cells genetically engineered as indicated. ( h ) Plot shows the quantification of strand width in spheroid invasion assay of A431 WT or MMP14 over-expressing cells, which are pre-treated with mitomycin C. Unpaired t-test was performed. Error bars indicate 95% confidence intervals, one dot represents one strand. For comparison, light blue lines show the same metrics in the absence of mitomycin C (data from ). Figure 3—figure supplement 1—source data 1. Quantification of invading strand width in A431 WT and MMP14 OE cells pretreated with mitomycin C. Figure 3—figure supplement 1—source data 2. Uncropped western blot images of WT, MMP14 KO, MMP14 OE, CTNNA1 KO, MMP14 KO/CTNNA1 KO, and MMP14 OE/CTNNA1 KO A431 lysates stained for MMP14, alpha-catenin, vimentin, fibronectin, or β-actin.

Journal: eLife

Article Title: Interplay of adherens junctions and matrix proteolysis determines the invasive pattern and growth of squamous cell carcinoma

doi: 10.7554/eLife.76520

Figure Lengend Snippet: ( a ) Heatmaps show how varying the cancer cell proteolysis value (x axis) impacts on different metrics in the absence of fibroblasts. WT indicates the ‘wild-type’ value based on experimental parameterisation using A431 cancer cells. ( b ) Heatmaps show the differential values resulting from the inclusion of fibroblasts (effectively a comparison of and Figure 3—figure supplement 1a). Red indicates an increase when fibroblasts are present, dark blue a reduction when in the presence of fibroblasts. ( c ) Images show simulation output initiated with a spheroid, no fibroblasts, a uniform chemotactic cue, and varying cancer cell proteolysis. Left panel – day 7output in the absence of permissive track, right panel – day 5 output in the presence of permissive track. ( d ) Heatmaps show how varying the distribution of extracellular matrix (ECM) density in organotypic simulations impacts on different metrics when fibroblasts are included in all simulations. Parametrisation and colourmap as in ( a ). ‘Aligned’ refers to alternating tracks of high and low ECM density parallel to direction of invasion. ‘Chessboard’ refers to three-dimensional (3D) chessboard distribution of high and low ECM density values. ( e ) Heatmaps show how varying the cancer cell proteolysis value (x axis) impacts on different metrics when cancer-cell proliferation rate is halved, and fibroblasts are included in all simulations. Parametrisation and colourmap as in ( a ). ( f ) Western blots of MMP14, alpha-catenin, vimentin, fibronectin, and β-actin in A431 cells engineered using Crispr/Cas9 to delete MMP14 or CTNNA1, or to over-express MMP14. ( g ) Images show F-actin (magenta) and degraded collagen I represented by fluorescence of DQ collagen I (green) in 3D culture of A431 cells genetically engineered as indicated. ( h ) Plot shows the quantification of strand width in spheroid invasion assay of A431 WT or MMP14 over-expressing cells, which are pre-treated with mitomycin C. Unpaired t-test was performed. Error bars indicate 95% confidence intervals, one dot represents one strand. For comparison, light blue lines show the same metrics in the absence of mitomycin C (data from ). Figure 3—figure supplement 1—source data 1. Quantification of invading strand width in A431 WT and MMP14 OE cells pretreated with mitomycin C. Figure 3—figure supplement 1—source data 2. Uncropped western blot images of WT, MMP14 KO, MMP14 OE, CTNNA1 KO, MMP14 KO/CTNNA1 KO, and MMP14 OE/CTNNA1 KO A431 lysates stained for MMP14, alpha-catenin, vimentin, fibronectin, or β-actin.

Article Snippet: Transfected construct ( Homo-sapiens ) , px458 CTNNA1 gRNA , Santa Cruz , sc-419475 , .

Techniques: Comparison, Western Blot, CRISPR, Fluorescence, Invasion Assay, Expressing, Staining

( a ) Principal component analysis plots show the metrics derived from over 2000 simulations in the presence of fibroblasts covering variation in cancer cell–cancer cell adhesion with values indicated by the intensity of magenta, cancer cell proteolysis (not colour coded), and cancer cell–matrix adhesion (not colour coded). ( b ) Heatmaps show how varying the cancer cell–cancer cell adhesion value (x axis) impacts on different metrics when fibroblasts are included in all simulations. WT indicates the ‘wild-type’ value based on experimental parameterisation using A431 cancer cells. Yellow indicates a high value, dark blue a low value. ( c ) Images show the effect of modulating cancer cell-cell adhesion via Crispr KO of CTNNA1 in cancer cells (green) in both organotypic and spheroid assays including fibroblasts (magenta). Scale bar = 100 μm. ( d ) Quantification of three biological replicates of the experiment shown in panel (c) with strand length, strand width, and tapering shown – 1 unit is equivalent to 0.52 μm. Unpaired t-test was performed. Error bars indicate 95% confidence intervals, one dot represents one strand. ( e ) Plots show the track invasion score with varying cancer cell–cancer cell adhesion in simulations lacking fibroblasts but with a single permissive track favouring invasion. Cartoons indicate the initial set up of cell positions and the directional cue in the simulation. Figure 5—source data 1. Quantification of invading strand length, width, and tapering in A431 cells with/without CTNNA1 manipulation.

Journal: eLife

Article Title: Interplay of adherens junctions and matrix proteolysis determines the invasive pattern and growth of squamous cell carcinoma

doi: 10.7554/eLife.76520

Figure Lengend Snippet: ( a ) Principal component analysis plots show the metrics derived from over 2000 simulations in the presence of fibroblasts covering variation in cancer cell–cancer cell adhesion with values indicated by the intensity of magenta, cancer cell proteolysis (not colour coded), and cancer cell–matrix adhesion (not colour coded). ( b ) Heatmaps show how varying the cancer cell–cancer cell adhesion value (x axis) impacts on different metrics when fibroblasts are included in all simulations. WT indicates the ‘wild-type’ value based on experimental parameterisation using A431 cancer cells. Yellow indicates a high value, dark blue a low value. ( c ) Images show the effect of modulating cancer cell-cell adhesion via Crispr KO of CTNNA1 in cancer cells (green) in both organotypic and spheroid assays including fibroblasts (magenta). Scale bar = 100 μm. ( d ) Quantification of three biological replicates of the experiment shown in panel (c) with strand length, strand width, and tapering shown – 1 unit is equivalent to 0.52 μm. Unpaired t-test was performed. Error bars indicate 95% confidence intervals, one dot represents one strand. ( e ) Plots show the track invasion score with varying cancer cell–cancer cell adhesion in simulations lacking fibroblasts but with a single permissive track favouring invasion. Cartoons indicate the initial set up of cell positions and the directional cue in the simulation. Figure 5—source data 1. Quantification of invading strand length, width, and tapering in A431 cells with/without CTNNA1 manipulation.

Article Snippet: Transfected construct ( Homo-sapiens ) , px458 CTNNA1 gRNA , Santa Cruz , sc-419475 , .

Techniques: Derivative Assay, CRISPR

( a ) Images show the β-catenin (magenta), F-actin (orange), DNA (blue), and active myosin (pS19-MLC - green) networks in control A431 and CTNNA1 KO A431 cells.( b ) Images β-catenin (magenta), F-actin (orange), DNA (blue), and active myosin (pS19-MLC - green) networks in control A431- and 10-μM Y27632-treated cells. Scale bar = 20 μm. ( c ) Images show β-catenin (magenta), F-actin (orange), DNA (blue), and active myosin (pS19-MLC - green) networks in control A431 ROCK:ER- and 4-OHT-treated cells. Scale bar = 20 μm. ( d ) Images show organotypic killing assays using control or MMP14 over-expressing A431 cells in the presence or absence of 10 μM Y27632. Scale bar = 100 μm. Plot shows the quantification of strand width from three biological replicates – 1 unit is equivalent to 0.52 μm. One-way ANOVA with post-hoc multiple comparisons was performed. Error bars indicate 95% confidence intervals, one dot represents one strand. ( e ) Images show organotypic invasion assays using MMP14 over-expressing A431 cells additionally engineered to contain ROCK:ER in the presence or absence of 4-OHT. Scale bar = 100 μm. Plot shows the quantification of strand width from three biological replicates. Unpaired t-test was performed. Error bars indicate 95% confidence intervals, one dot represents one strand. Figure 6—source data 1. Quantification of invading strand width in A431 cells with/without manipulation of actomyosin contractility.

Journal: eLife

Article Title: Interplay of adherens junctions and matrix proteolysis determines the invasive pattern and growth of squamous cell carcinoma

doi: 10.7554/eLife.76520

Figure Lengend Snippet: ( a ) Images show the β-catenin (magenta), F-actin (orange), DNA (blue), and active myosin (pS19-MLC - green) networks in control A431 and CTNNA1 KO A431 cells.( b ) Images β-catenin (magenta), F-actin (orange), DNA (blue), and active myosin (pS19-MLC - green) networks in control A431- and 10-μM Y27632-treated cells. Scale bar = 20 μm. ( c ) Images show β-catenin (magenta), F-actin (orange), DNA (blue), and active myosin (pS19-MLC - green) networks in control A431 ROCK:ER- and 4-OHT-treated cells. Scale bar = 20 μm. ( d ) Images show organotypic killing assays using control or MMP14 over-expressing A431 cells in the presence or absence of 10 μM Y27632. Scale bar = 100 μm. Plot shows the quantification of strand width from three biological replicates – 1 unit is equivalent to 0.52 μm. One-way ANOVA with post-hoc multiple comparisons was performed. Error bars indicate 95% confidence intervals, one dot represents one strand. ( e ) Images show organotypic invasion assays using MMP14 over-expressing A431 cells additionally engineered to contain ROCK:ER in the presence or absence of 4-OHT. Scale bar = 100 μm. Plot shows the quantification of strand width from three biological replicates. Unpaired t-test was performed. Error bars indicate 95% confidence intervals, one dot represents one strand. Figure 6—source data 1. Quantification of invading strand width in A431 cells with/without manipulation of actomyosin contractility.

Article Snippet: Transfected construct ( Homo-sapiens ) , px458 CTNNA1 gRNA , Santa Cruz , sc-419475 , .

Techniques: Control, Expressing

( a ) Plots show the quantifications of relative intensity of pMLC in A431 WT, CTNNA1 KO, A431 WT cells treated with Y27632 and ROCK:ER expressing A431 ± 4(O)HT at the edge or cell-cell junction of the cells. Mean, quartiles, and extremes are shown, data from 3 independent experiments. ( b ) Images show the F-actin (magenta) and myosin (MYH9/MHCIIa - green) networks in control A431- and 10-μM Y27632-treated cells. Scale bar = 20 μm. ( c ) Images show the F-actin (magenta) and myosin (MYH9/MHCIIa - green) networks in control A431 ROCK:ER with/without 4-OHT treatment. Scale bar = 20 μm. ( d ) Images show the F-actin (magenta), DNA (DAPI; blue), and MYH9/MHCIIA (green) staining in human squamous cell carcinoma tissue. ‘t’ indicates tumour clusters, arrows point to supra-cellular actomyosin network, scale bar is 50 microns. Figure 6—figure supplement 1—source data 1. Quantification of pMLC intensity in A431 WT, CTNNA1 KO, and cells with actomyosin manipulation.

Journal: eLife

Article Title: Interplay of adherens junctions and matrix proteolysis determines the invasive pattern and growth of squamous cell carcinoma

doi: 10.7554/eLife.76520

Figure Lengend Snippet: ( a ) Plots show the quantifications of relative intensity of pMLC in A431 WT, CTNNA1 KO, A431 WT cells treated with Y27632 and ROCK:ER expressing A431 ± 4(O)HT at the edge or cell-cell junction of the cells. Mean, quartiles, and extremes are shown, data from 3 independent experiments. ( b ) Images show the F-actin (magenta) and myosin (MYH9/MHCIIa - green) networks in control A431- and 10-μM Y27632-treated cells. Scale bar = 20 μm. ( c ) Images show the F-actin (magenta) and myosin (MYH9/MHCIIa - green) networks in control A431 ROCK:ER with/without 4-OHT treatment. Scale bar = 20 μm. ( d ) Images show the F-actin (magenta), DNA (DAPI; blue), and MYH9/MHCIIA (green) staining in human squamous cell carcinoma tissue. ‘t’ indicates tumour clusters, arrows point to supra-cellular actomyosin network, scale bar is 50 microns. Figure 6—figure supplement 1—source data 1. Quantification of pMLC intensity in A431 WT, CTNNA1 KO, and cells with actomyosin manipulation.

Article Snippet: Transfected construct ( Homo-sapiens ) , px458 CTNNA1 gRNA , Santa Cruz , sc-419475 , .

Techniques: Expressing, Control, Staining

( a ) Heatmaps show how varying the matrix proteolysis (x-axis) and cancer cell–cancer cell adhesion value (y axis) impacts on different metrics when fibroblasts are included in all simulations. WT indicates the ‘wild-type’ value based on experimental parameterisation using A431 cancer cells. Yellow indicates a high value, dark blue a low value. ( b ) Images show the effect of combinatorial modulation of matrix proteolysis and cancer cell-cell adhesion via Crispr KO of CTNNA1 and/or MMP14 and/or MMP14 over-expression in cancer cells (green) in both organotypic assays including fibroblasts (magenta). Scale bar = 100 μm. ( c ) Quantification of three biological replicates of the experiment shown in panel (b) with strand length and strand width shown – 1 unit is equivalent to 0.52 μm. One-way ANOVA with post-hoc multiple comparisons was performed. Error bars indicate 95% confidence interval, one dot represents one strand. ( d ) Images show the effect of combinatorial modulation of matrix proteolysis and cancer cell-cell adhesion via Crispr KO of CTNNA1 and/or MMP14 and/or MMP14 over-expression in cancer cells (green) in both spheroid assays including fibroblasts (magenta). ( e ) Quantification of three biological replicates of the experiment shown in panel (d) with strand length and strand width shown. Scale bar = 100 μm. One-way ANOVA with post-hoc multiple comparisons was performed. Error bars indicate 95% confidence interval, one dot represents one strand. Figure 7—source data 1. Quantification of invading strand width and length in A431 cells with/without manipulation of MMP14 and/or CTNNA1.

Journal: eLife

Article Title: Interplay of adherens junctions and matrix proteolysis determines the invasive pattern and growth of squamous cell carcinoma

doi: 10.7554/eLife.76520

Figure Lengend Snippet: ( a ) Heatmaps show how varying the matrix proteolysis (x-axis) and cancer cell–cancer cell adhesion value (y axis) impacts on different metrics when fibroblasts are included in all simulations. WT indicates the ‘wild-type’ value based on experimental parameterisation using A431 cancer cells. Yellow indicates a high value, dark blue a low value. ( b ) Images show the effect of combinatorial modulation of matrix proteolysis and cancer cell-cell adhesion via Crispr KO of CTNNA1 and/or MMP14 and/or MMP14 over-expression in cancer cells (green) in both organotypic assays including fibroblasts (magenta). Scale bar = 100 μm. ( c ) Quantification of three biological replicates of the experiment shown in panel (b) with strand length and strand width shown – 1 unit is equivalent to 0.52 μm. One-way ANOVA with post-hoc multiple comparisons was performed. Error bars indicate 95% confidence interval, one dot represents one strand. ( d ) Images show the effect of combinatorial modulation of matrix proteolysis and cancer cell-cell adhesion via Crispr KO of CTNNA1 and/or MMP14 and/or MMP14 over-expression in cancer cells (green) in both spheroid assays including fibroblasts (magenta). ( e ) Quantification of three biological replicates of the experiment shown in panel (d) with strand length and strand width shown. Scale bar = 100 μm. One-way ANOVA with post-hoc multiple comparisons was performed. Error bars indicate 95% confidence interval, one dot represents one strand. Figure 7—source data 1. Quantification of invading strand width and length in A431 cells with/without manipulation of MMP14 and/or CTNNA1.

Article Snippet: Transfected construct ( Homo-sapiens ) , px458 CTNNA1 gRNA , Santa Cruz , sc-419475 , .

Techniques: CRISPR, Over Expression

( a ) Images show EdU-labeled proliferating cells (green) and DNA (blue) in spheroid invasion assay with A431 WT, MMP14 KO, MMP14 OE, or CTNNA1 KO (magenta). ( b ) Plot shows the quantification of EdU-labeled cells shown in (a). One-way ANOVA with post-hoc multiple comparisons was performed. Error bars indicate 95% confidence intervals, n=3 biological replicates. ( c ) Plot shows quantification of growth of A431 cells with the indicated manipulations of MMP14 and CTNNA1 in two-dimensional cell culture. Two-way ANOVA with post-hoc multiple comparisons was performed. Error bars indicate 95% confidence intervals, n=3 biological replicates. ( b ) Phase contrast images show the growth of A431 ROCK:ER cancer cell colonies in the presence or absence of 4-OHT. Scale bar = 50 μm. ( c ) Plot shows quantification of the growth assay shown in (b). Data from three biological replicates. Two-way ANOVA with post-hoc multiple comparisons was performed. Error bars indicate 95% confidence intervals, n=3 biological replicates. Figure 8—figure supplement 1—source data 1. Quantification of proliferation of WT, MMP14, CTNNA1, and/or ROCKER manipulated A431 in 2D and 3D culture.

Journal: eLife

Article Title: Interplay of adherens junctions and matrix proteolysis determines the invasive pattern and growth of squamous cell carcinoma

doi: 10.7554/eLife.76520

Figure Lengend Snippet: ( a ) Images show EdU-labeled proliferating cells (green) and DNA (blue) in spheroid invasion assay with A431 WT, MMP14 KO, MMP14 OE, or CTNNA1 KO (magenta). ( b ) Plot shows the quantification of EdU-labeled cells shown in (a). One-way ANOVA with post-hoc multiple comparisons was performed. Error bars indicate 95% confidence intervals, n=3 biological replicates. ( c ) Plot shows quantification of growth of A431 cells with the indicated manipulations of MMP14 and CTNNA1 in two-dimensional cell culture. Two-way ANOVA with post-hoc multiple comparisons was performed. Error bars indicate 95% confidence intervals, n=3 biological replicates. ( b ) Phase contrast images show the growth of A431 ROCK:ER cancer cell colonies in the presence or absence of 4-OHT. Scale bar = 50 μm. ( c ) Plot shows quantification of the growth assay shown in (b). Data from three biological replicates. Two-way ANOVA with post-hoc multiple comparisons was performed. Error bars indicate 95% confidence intervals, n=3 biological replicates. Figure 8—figure supplement 1—source data 1. Quantification of proliferation of WT, MMP14, CTNNA1, and/or ROCKER manipulated A431 in 2D and 3D culture.

Article Snippet: Transfected construct ( Homo-sapiens ) , px458 CTNNA1 gRNA , Santa Cruz , sc-419475 , .

Techniques: Labeling, Invasion Assay, Cell Culture, Growth Assay

( a ) Heatmaps show how varying the matrix proteolysis (left) or cancer cell–cancer cell adhesion value (right) impacts on predicted cell growth in the presence or absence of fibroblasts. WT indicates the ‘wild-type’ value based on experimental parameterisation using A431 cancer cells. Yellow indicates a high value, dark blue a low value. ( b ) Phase contrast images show the growth of cancer cell colonies with the indicated manipulations of MMP14 and CTNNA1 after 8 days surrounded by matrix. Scale bar = 50 μm. ( c ) Plot shows quantification of the growth assay shown in (b). Two-way ANOVA with post-hoc multiple comparisons was performed. Error bars indicate 95% confidence intervals. Data from three biological replicates. ( d ) Fluorescent image shows reflectance of collagen fibre (cyan) and cell membrane of A431 WT cells in three-dimensional (3D) culture. ( e ) Fluorescent image shows reflectance of collagen fibres around A431 WT cells in 3D culture at two time points. t=0 min: magenta, t=100 min: green. ( f ) Fluorescent images show reflectance of collagen fibres (cyan) and cell membrane of A431 WT, CRNNA1 KO, or MMP14 over expressing cells (red) in 3D culture. White arrows highlight the formation and motion of collagen bundles adjacent to the cell clusters, yellow arrows highlight gaps. Figure 8—source data 1. Quantification of cancer cell proliferation in 3D culture.

Journal: eLife

Article Title: Interplay of adherens junctions and matrix proteolysis determines the invasive pattern and growth of squamous cell carcinoma

doi: 10.7554/eLife.76520

Figure Lengend Snippet: ( a ) Heatmaps show how varying the matrix proteolysis (left) or cancer cell–cancer cell adhesion value (right) impacts on predicted cell growth in the presence or absence of fibroblasts. WT indicates the ‘wild-type’ value based on experimental parameterisation using A431 cancer cells. Yellow indicates a high value, dark blue a low value. ( b ) Phase contrast images show the growth of cancer cell colonies with the indicated manipulations of MMP14 and CTNNA1 after 8 days surrounded by matrix. Scale bar = 50 μm. ( c ) Plot shows quantification of the growth assay shown in (b). Two-way ANOVA with post-hoc multiple comparisons was performed. Error bars indicate 95% confidence intervals. Data from three biological replicates. ( d ) Fluorescent image shows reflectance of collagen fibre (cyan) and cell membrane of A431 WT cells in three-dimensional (3D) culture. ( e ) Fluorescent image shows reflectance of collagen fibres around A431 WT cells in 3D culture at two time points. t=0 min: magenta, t=100 min: green. ( f ) Fluorescent images show reflectance of collagen fibres (cyan) and cell membrane of A431 WT, CRNNA1 KO, or MMP14 over expressing cells (red) in 3D culture. White arrows highlight the formation and motion of collagen bundles adjacent to the cell clusters, yellow arrows highlight gaps. Figure 8—source data 1. Quantification of cancer cell proliferation in 3D culture.

Article Snippet: Transfected construct ( Homo-sapiens ) , px458 CTNNA1 gRNA , Santa Cruz , sc-419475 , .

Techniques: Growth Assay, Membrane, Expressing

( a ) H&E images are shown on tumours growing in the ears of mice with the indicated manipulations of MMP14 and CTNNA1. Scale bar = 50 μm. ( b ) Plot shows quantification of A431 tumour growth with the indicated manipulations of MMP14 and CTNNA1. ( c ) Table shows quantification of mice with primary tumours and mice with lymph node metastases when injected with A431 cells with the indicated manipulations of MMP14 and CTNNA1. The total number of mice for each condition also applies to the data plotted in (b). Two-way ANOVA with post-hoc multiple comparisons was performed. Error bars indicate 95% confidence intervals. Figure 9—source data 1. Tumour size and number of metastasis in WT and MMP14 and/or CTNNA1 manipulated tumour-bearing mice.

Journal: eLife

Article Title: Interplay of adherens junctions and matrix proteolysis determines the invasive pattern and growth of squamous cell carcinoma

doi: 10.7554/eLife.76520

Figure Lengend Snippet: ( a ) H&E images are shown on tumours growing in the ears of mice with the indicated manipulations of MMP14 and CTNNA1. Scale bar = 50 μm. ( b ) Plot shows quantification of A431 tumour growth with the indicated manipulations of MMP14 and CTNNA1. ( c ) Table shows quantification of mice with primary tumours and mice with lymph node metastases when injected with A431 cells with the indicated manipulations of MMP14 and CTNNA1. The total number of mice for each condition also applies to the data plotted in (b). Two-way ANOVA with post-hoc multiple comparisons was performed. Error bars indicate 95% confidence intervals. Figure 9—source data 1. Tumour size and number of metastasis in WT and MMP14 and/or CTNNA1 manipulated tumour-bearing mice.

Article Snippet: Transfected construct ( Homo-sapiens ) , px458 CTNNA1 gRNA , Santa Cruz , sc-419475 , .

Techniques: Injection

Journal: eLife

Article Title: Interplay of adherens junctions and matrix proteolysis determines the invasive pattern and growth of squamous cell carcinoma

doi: 10.7554/eLife.76520

Figure Lengend Snippet:

Article Snippet: Transfected construct ( Homo-sapiens ) , px458 CTNNA1 gRNA , Santa Cruz , sc-419475 , .

Techniques: Transfection, Construct, Sequencing, Control, Generated, Membrane, Imaging

(A) Flow cytometry histogram showing surface staining of Galectin-1 in naive (gray), memory (blue), and PCs (red) in human peripheral blood B cells (left panel). Isotype control is shown by gray-dotted histogram. Graph shows fold increase in surface Galectin-1 staining (MFI) relative to naive B cells (n = 4). Contour plot depicts CD45 activity versus Galectin-1 surface staining in B cells (blue) and PCs (CD138 hi CD38 hi ) (red) backgated to CD45 activity hi Galectin-1 hi cells (right panel). (B) Histograms show CD45 activity (left panel), Galectin-1 staining (middle panel), and MEM-55 staining (right panel) in CTR- or NA-treated B cells. Graphs show fold increase in MFI of CD45 phosphatase activity (left lower panel) and Galectin-1 staining (right lower panel) relative to CTR-treated B cells (n = 6). (C) Upper panels: Dot plots show expression of IRF4 and BLIMP1 in naive B cells and MBCs differentiated toward ASCs in the presence of 10 and 100 µM OTX008 or VEH. Graph shows % IRF4 + BLIMP1 + B cells in MBC cultures. Lower panels: Galectin-1 surface expression (left panel) and CD45 phosphatase activity (right panel) in VEH-treated (blue histogram) and OTX-treated (blue dotted histogram) MBCs. Graphs show MFI values of Galectin-1 staining (left) and CD45 activity (right) (n = 5). (D) Flow cytometry dot plots show CD45 activity versus Galectin-1 surface staining in the presence of medium or rhGAL-1 (left panels). Histogram shows CD45 phosphatase activity of Galectin-1 hi B cells with rhGAL1 (blue) and total B cells (gray) (middle panel). Graph shows MFI values of CD45 activity in total B cells (gray histogram) and GAL-1 hi (blue open histogram) B cells (right panel) (n = 6). (E) Representative localization of Galectin-1 relative to pSyk, pCAP-SP1, and CD45 in human B cells. The panels (left) present signals from the individual fluorescence detectors, and the center image is a merge of all four channels. The graph (right) shows the average (z axis) fluorescence intensity for each (x axis) pixel number in the indicated area (below graph and dotted area on center figure). (F) CoIP of CD45 of B cell lysates and immunoblotted with anti-CD45 (left) or anti-Galectin-1 (right). (G) Flow cytometry histogram showing CD45 phosphatase activity in gated live Raji B cells with CRISPR-Cas9 knockdown of CD45 (blue), Galectin-1 (green), and wild-type (red). Related to and . *p < 0.05, **p < 0.01.

Journal: Cell reports

Article Title: Integration of T helper and BCR signals governs enhanced plasma cell differentiation of memory B cells by regulation of CD45 phosphatase activity

doi: 10.1016/j.celrep.2021.109525

Figure Lengend Snippet: (A) Flow cytometry histogram showing surface staining of Galectin-1 in naive (gray), memory (blue), and PCs (red) in human peripheral blood B cells (left panel). Isotype control is shown by gray-dotted histogram. Graph shows fold increase in surface Galectin-1 staining (MFI) relative to naive B cells (n = 4). Contour plot depicts CD45 activity versus Galectin-1 surface staining in B cells (blue) and PCs (CD138 hi CD38 hi ) (red) backgated to CD45 activity hi Galectin-1 hi cells (right panel). (B) Histograms show CD45 activity (left panel), Galectin-1 staining (middle panel), and MEM-55 staining (right panel) in CTR- or NA-treated B cells. Graphs show fold increase in MFI of CD45 phosphatase activity (left lower panel) and Galectin-1 staining (right lower panel) relative to CTR-treated B cells (n = 6). (C) Upper panels: Dot plots show expression of IRF4 and BLIMP1 in naive B cells and MBCs differentiated toward ASCs in the presence of 10 and 100 µM OTX008 or VEH. Graph shows % IRF4 + BLIMP1 + B cells in MBC cultures. Lower panels: Galectin-1 surface expression (left panel) and CD45 phosphatase activity (right panel) in VEH-treated (blue histogram) and OTX-treated (blue dotted histogram) MBCs. Graphs show MFI values of Galectin-1 staining (left) and CD45 activity (right) (n = 5). (D) Flow cytometry dot plots show CD45 activity versus Galectin-1 surface staining in the presence of medium or rhGAL-1 (left panels). Histogram shows CD45 phosphatase activity of Galectin-1 hi B cells with rhGAL1 (blue) and total B cells (gray) (middle panel). Graph shows MFI values of CD45 activity in total B cells (gray histogram) and GAL-1 hi (blue open histogram) B cells (right panel) (n = 6). (E) Representative localization of Galectin-1 relative to pSyk, pCAP-SP1, and CD45 in human B cells. The panels (left) present signals from the individual fluorescence detectors, and the center image is a merge of all four channels. The graph (right) shows the average (z axis) fluorescence intensity for each (x axis) pixel number in the indicated area (below graph and dotted area on center figure). (F) CoIP of CD45 of B cell lysates and immunoblotted with anti-CD45 (left) or anti-Galectin-1 (right). (G) Flow cytometry histogram showing CD45 phosphatase activity in gated live Raji B cells with CRISPR-Cas9 knockdown of CD45 (blue), Galectin-1 (green), and wild-type (red). Related to and . *p < 0.05, **p < 0.01.

Article Snippet: In brief, ablation of the LGALS1 gene from the Raji cell line was achieved by electroporation of target cells with the Neon Transfection system (Thermo Fischer) using the Cas9/gRNA vector pSpCas9(BB)-2A-GFP (PX458), generously provided by Dr. Feng Zhang through the Addgene repository (Addgene #48138) utilizing the following guide RNA template sequence: hCD45: 5´-TGGCTTAAACTCTTGGCATT-3´, hLGALS_s1: 5´-CGCCGTGGGCGTTGAAGCGA-3´.

Techniques: Flow Cytometry, Staining, Activity Assay, Expressing, Fluorescence, CRISPR

KEY RESOURCES TABLE

Journal: Cell reports

Article Title: Integration of T helper and BCR signals governs enhanced plasma cell differentiation of memory B cells by regulation of CD45 phosphatase activity

doi: 10.1016/j.celrep.2021.109525

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: In brief, ablation of the LGALS1 gene from the Raji cell line was achieved by electroporation of target cells with the Neon Transfection system (Thermo Fischer) using the Cas9/gRNA vector pSpCas9(BB)-2A-GFP (PX458), generously provided by Dr. Feng Zhang through the Addgene repository (Addgene #48138) utilizing the following guide RNA template sequence: hCD45: 5´-TGGCTTAAACTCTTGGCATT-3´, hLGALS_s1: 5´-CGCCGTGGGCGTTGAAGCGA-3´.

Techniques: Negative Control, Recombinant, Purification, Staining, Expressing, Lysis, Immunoprecipitation, Plasmid Preparation, Enzyme-linked Immunosorbent Assay, Blocking Assay, Cell Isolation, Software, Microscopy

(a) Schematic diagram of the selection of T2D and FG-associated variants used in the assignments of 3D targets analysis (see also Methods , Extended Data 1 and Supplementary Table 1 ). (b) Map of the CDC123/CAMK1D locus (an alternative representation of the same region depicted in ) showing pcHi-C high-confidence interactions (pink) and imputed assignments (grey). (c) Luciferase assay in the human β cell line EndoC-βH3 shows allele-dependent activity for the rs11257655-enhancer. Data are presented as mean ± s.d. Two independent experiments were performed in quadruplicates. ** P <0.01, two-tailed Student’s t-test (d,e) Analysis of OPTN and CAMK1D mRNA after CRISPR inhibition (CRISPRi) of the rs11257655-enhancer in EndoC-βH3 cells (d) and (e) HepG2 cells. Bars show average values of three guide RNAs targeting either the rs11257655 enhancer, or the OPTN transcriptional start site as control. Data are presented as mean ± s.d. Two independent experiments were performed in triplicates. Data shown was normalized by RPLP0 and is shown relative to the mean levels of the negative controls. ** P <0.01, *** P <0.001, two-tailed Student’s t-test. (f) Analysis of OPTN and CAMK1D mRNA after CRISPR activation (CRISPRa) in EndoC-βH3 cells. Analysis as in panel D. (g) Analysis of the T2D-associated locus TCF7L2 . Virtual 4C maps centered on all genes in this locus show that the T2D-associated regulatory variant rs7903146 connects with TCF7L2 through moderate-confidence interactions and an imputed assignment, but shows no evidence for interactions with other genes. The HindIII fragment that contains the enhancer is highlighted in yellow. The bottom panel shows that this enhancer shows an unusually strong occupancy by Mediator, in addition to islet-enriched transcription factors. (h) Analysis of active islet genes in this locus, TCF7L2, VT11A, HABP2, ACSL5 in EndoC-βH3 cells after deletion of either the rs7903146-enhancer or a control region in the same locus (see ). Deletions were tested with 2 different guide RNA pairs. Data are presented as mean ± s.d. Two independent experiments were performed in triplicates. Data was normalized by RPLP0 and is shown relative to the mean levels of the negative control deletions. *** P <0.001, two-tailed Student’s t-test. (i) Analysis of TCF7L2, VT11A, HABP2 mRNA in EndoC-βH3 cells after CRISPR activation (CRISPRa) of this enhancer. The analysis was carried out as in panel H. *** P <0.001, two-tailed Student’s t-test.

Journal: bioRxiv

Article Title: Human pancreatic islet 3D chromatin architecture provides insights into the genetics of type 2 diabetes

doi: 10.1101/400291

Figure Lengend Snippet: (a) Schematic diagram of the selection of T2D and FG-associated variants used in the assignments of 3D targets analysis (see also Methods , Extended Data 1 and Supplementary Table 1 ). (b) Map of the CDC123/CAMK1D locus (an alternative representation of the same region depicted in ) showing pcHi-C high-confidence interactions (pink) and imputed assignments (grey). (c) Luciferase assay in the human β cell line EndoC-βH3 shows allele-dependent activity for the rs11257655-enhancer. Data are presented as mean ± s.d. Two independent experiments were performed in quadruplicates. ** P <0.01, two-tailed Student’s t-test (d,e) Analysis of OPTN and CAMK1D mRNA after CRISPR inhibition (CRISPRi) of the rs11257655-enhancer in EndoC-βH3 cells (d) and (e) HepG2 cells. Bars show average values of three guide RNAs targeting either the rs11257655 enhancer, or the OPTN transcriptional start site as control. Data are presented as mean ± s.d. Two independent experiments were performed in triplicates. Data shown was normalized by RPLP0 and is shown relative to the mean levels of the negative controls. ** P <0.01, *** P <0.001, two-tailed Student’s t-test. (f) Analysis of OPTN and CAMK1D mRNA after CRISPR activation (CRISPRa) in EndoC-βH3 cells. Analysis as in panel D. (g) Analysis of the T2D-associated locus TCF7L2 . Virtual 4C maps centered on all genes in this locus show that the T2D-associated regulatory variant rs7903146 connects with TCF7L2 through moderate-confidence interactions and an imputed assignment, but shows no evidence for interactions with other genes. The HindIII fragment that contains the enhancer is highlighted in yellow. The bottom panel shows that this enhancer shows an unusually strong occupancy by Mediator, in addition to islet-enriched transcription factors. (h) Analysis of active islet genes in this locus, TCF7L2, VT11A, HABP2, ACSL5 in EndoC-βH3 cells after deletion of either the rs7903146-enhancer or a control region in the same locus (see ). Deletions were tested with 2 different guide RNA pairs. Data are presented as mean ± s.d. Two independent experiments were performed in triplicates. Data was normalized by RPLP0 and is shown relative to the mean levels of the negative control deletions. *** P <0.001, two-tailed Student’s t-test. (i) Analysis of TCF7L2, VT11A, HABP2 mRNA in EndoC-βH3 cells after CRISPR activation (CRISPRa) of this enhancer. The analysis was carried out as in panel H. *** P <0.001, two-tailed Student’s t-test.

Article Snippet: Related to . gRNAs targeting transcriptional start site regions were retrieved from the Human Genome-wide CRISPRi-v2 and CRISPRa-v2 top5 libraries, respectively , and previously validated negative control gRNAs targeting sequences not present in the human genome were retrieved from Addgene ( https://www.addgene.org/crispr/reference/grna-sequence/ ).

Techniques: Selection, Luciferase, Activity Assay, Two Tailed Test, CRISPR, Inhibition, Control, Activation Assay, Variant Assay, Negative Control

( A ) Lysates of HEK293T cells expressing FLAG-tagged human KLHL proteins were subjected to immunoprecipitation (IP) with antibodies to FLAG, and the resulting precipitates as well as the original lysates (Input) were subjected to immunoblot analysis with the indicated antibodies (α-). GAPDH was examined as a loading control. ( B ) Lysates of HEK293T cells expressing FLAG-tagged human KLHL3 or Keap1 together with HA-tagged human Cul3 were subjected to immunoprecipitation with antibodies to FLAG, and the resulting precipitates as well as the original lysates were subjected to immunoblot analysis with the indicated antibodies. GAPDH was examined as a loading control. ( C ) Fifty-three BTB proteins previously found to interact with Cul3 in HEK293T cells . Z and NWD scores were obtained from CompPASS analysis . Cul3 interactants in the BioPlex 3.0 database are shown in green, with others shown in gray. ( D and E ) Representative ITC titration curves for interaction between human Cul3(N) and either human KLHL3(N) (D) or human Keap1(N) (E) as well as domain organization of the protein fragments. Baseline-corrected differential power (DP) versus time as well as the normalized binding curve, with integrated changes in enthalpy (Δ H ) plotted against molar ratio, are shown. Each experiment was performed independently at least twice. ( F ) Dissociation constants for Cullins and the indicated receptors. Values other than those for Keap1 and KLHL3 were obtained from previous studies ( , , , – ). n.d., not detected.

Journal: Science Advances

Article Title: Molecular evolution of Keap1 was essential for adaptation of vertebrates to terrestrial life

doi: 10.1126/sciadv.adg2379

Figure Lengend Snippet: ( A ) Lysates of HEK293T cells expressing FLAG-tagged human KLHL proteins were subjected to immunoprecipitation (IP) with antibodies to FLAG, and the resulting precipitates as well as the original lysates (Input) were subjected to immunoblot analysis with the indicated antibodies (α-). GAPDH was examined as a loading control. ( B ) Lysates of HEK293T cells expressing FLAG-tagged human KLHL3 or Keap1 together with HA-tagged human Cul3 were subjected to immunoprecipitation with antibodies to FLAG, and the resulting precipitates as well as the original lysates were subjected to immunoblot analysis with the indicated antibodies. GAPDH was examined as a loading control. ( C ) Fifty-three BTB proteins previously found to interact with Cul3 in HEK293T cells . Z and NWD scores were obtained from CompPASS analysis . Cul3 interactants in the BioPlex 3.0 database are shown in green, with others shown in gray. ( D and E ) Representative ITC titration curves for interaction between human Cul3(N) and either human KLHL3(N) (D) or human Keap1(N) (E) as well as domain organization of the protein fragments. Baseline-corrected differential power (DP) versus time as well as the normalized binding curve, with integrated changes in enthalpy (Δ H ) plotted against molar ratio, are shown. Each experiment was performed independently at least twice. ( F ) Dissociation constants for Cullins and the indicated receptors. Values other than those for Keap1 and KLHL3 were obtained from previous studies ( , , , – ). n.d., not detected.

Article Snippet: Complementary oligonucleotides containing the human Keap1 single-guide RNA (sgRNA) target sequences (table S2) were annealed and cloned into the Bbs I site of pX330 (Addgene).

Techniques: Expressing, Immunoprecipitation, Western Blot, Control, Titration, Binding Assay

( A ) Alignment of amino acid sequences for the BTB domains of human (h) KLHL3, KLHL11, SPOP, and Keap1. Information on secondary structure was obtained from PDB (4HXI for KLHL3, 4AP2 for KLHL11, 4EOZ for SPOP, and 4CXI for Keap1). The numbers of α helices and β sheets are in accordance with a previous study . ( B ) Domain organization of human Keap1, human KLHL3, and the exchange mutant proteins Keap1(N3) and Keap1(W→3) as well as a summary of their interaction with Cul3 as determined in (C). ( C ) HEK293T cells expressing FLAG-tagged wild-type (WT) or mutant forms of human Keap1 together with HA-tagged human Cul3 were incubated in the absence or presence of 25 μM tBHQ for 24 hours, lysed, and subjected to immunoprecipitation with antibodies to FLAG. The resulting precipitates as well as the original cell lysates were subjected to immunoblot analysis with the indicated antibodies.

Journal: Science Advances

Article Title: Molecular evolution of Keap1 was essential for adaptation of vertebrates to terrestrial life

doi: 10.1126/sciadv.adg2379

Figure Lengend Snippet: ( A ) Alignment of amino acid sequences for the BTB domains of human (h) KLHL3, KLHL11, SPOP, and Keap1. Information on secondary structure was obtained from PDB (4HXI for KLHL3, 4AP2 for KLHL11, 4EOZ for SPOP, and 4CXI for Keap1). The numbers of α helices and β sheets are in accordance with a previous study . ( B ) Domain organization of human Keap1, human KLHL3, and the exchange mutant proteins Keap1(N3) and Keap1(W→3) as well as a summary of their interaction with Cul3 as determined in (C). ( C ) HEK293T cells expressing FLAG-tagged wild-type (WT) or mutant forms of human Keap1 together with HA-tagged human Cul3 were incubated in the absence or presence of 25 μM tBHQ for 24 hours, lysed, and subjected to immunoprecipitation with antibodies to FLAG. The resulting precipitates as well as the original cell lysates were subjected to immunoblot analysis with the indicated antibodies.

Article Snippet: Complementary oligonucleotides containing the human Keap1 single-guide RNA (sgRNA) target sequences (table S2) were annealed and cloned into the Bbs I site of pX330 (Addgene).

Techniques: Mutagenesis, Expressing, Incubation, Immunoprecipitation, Western Blot

( A ) Phylogenetic tree for the BTB domain of Keap1 proteins. The numbers associated with the branches indicate bootstrap values. ( B to E ) Ratio of Keap1A and Keap1B mRNAs at the indicated developmental stages in O. latipes (B), D. rerio (C), X. laevis (D), and X. tropicalis (E). Data are derived from RNA-seq analysis in previous studies ( – ). ( F ) Alignment of amino acid sequences for the BTB domain of Keap1 proteins. Keap1A- or Keap1B-specific amino acids are highlighted in red or blue, respectively, with common amino acids shown in brown. ( G ) Domain organization of zKeap1A, zKeap1B, and the C3IR mutants zKeap1A(A→B) and zKeap1B(B→A) as well as a summary of their interaction with zCul3 as determined in (H) and (I). ( H and I ) Lysates of HEK293T cells expressing FLAG-tagged zKeap1A, zKeap1B, zKeap1A(A→B), or zKeap1B(B→A) together with HA-tagged zCul3A (H) or zCul3B (I) were subjected to immunoprecipitation with antibodies to FLAG. ( J ) Domain organization of human Keap1 and the C3IR mutants hKeap1(W→3), hKeap1(W→A), and hKeap1(W→B) as well as a summary of their interaction with human Cul3 as determined in (K). ( K ) Lysates of HEK293T cells expressing FLAG-tagged hKeap1, hKeap1(W→3), hKeap1(W→A), or hKeap1(W→B) together with HA-tagged hCul3 were subjected to immunoprecipitation with antibodies to FLAG. ( L and M ) Lysates of HEK293T cells expressing HA-tagged hCul3 together with FLAG-tagged hKeap1 or its exchange mutants containing C3IR of Keap1 proteins from the indicated species were subjected to immunoprecipitation with antibodies to FLAG (L). The relative extent of HA-hCul3 binding to the hKeap1 mutants was also quantitated by densitometry (M). Quantitative data are means from three independent experiments.

Journal: Science Advances

Article Title: Molecular evolution of Keap1 was essential for adaptation of vertebrates to terrestrial life

doi: 10.1126/sciadv.adg2379

Figure Lengend Snippet: ( A ) Phylogenetic tree for the BTB domain of Keap1 proteins. The numbers associated with the branches indicate bootstrap values. ( B to E ) Ratio of Keap1A and Keap1B mRNAs at the indicated developmental stages in O. latipes (B), D. rerio (C), X. laevis (D), and X. tropicalis (E). Data are derived from RNA-seq analysis in previous studies ( – ). ( F ) Alignment of amino acid sequences for the BTB domain of Keap1 proteins. Keap1A- or Keap1B-specific amino acids are highlighted in red or blue, respectively, with common amino acids shown in brown. ( G ) Domain organization of zKeap1A, zKeap1B, and the C3IR mutants zKeap1A(A→B) and zKeap1B(B→A) as well as a summary of their interaction with zCul3 as determined in (H) and (I). ( H and I ) Lysates of HEK293T cells expressing FLAG-tagged zKeap1A, zKeap1B, zKeap1A(A→B), or zKeap1B(B→A) together with HA-tagged zCul3A (H) or zCul3B (I) were subjected to immunoprecipitation with antibodies to FLAG. ( J ) Domain organization of human Keap1 and the C3IR mutants hKeap1(W→3), hKeap1(W→A), and hKeap1(W→B) as well as a summary of their interaction with human Cul3 as determined in (K). ( K ) Lysates of HEK293T cells expressing FLAG-tagged hKeap1, hKeap1(W→3), hKeap1(W→A), or hKeap1(W→B) together with HA-tagged hCul3 were subjected to immunoprecipitation with antibodies to FLAG. ( L and M ) Lysates of HEK293T cells expressing HA-tagged hCul3 together with FLAG-tagged hKeap1 or its exchange mutants containing C3IR of Keap1 proteins from the indicated species were subjected to immunoprecipitation with antibodies to FLAG (L). The relative extent of HA-hCul3 binding to the hKeap1 mutants was also quantitated by densitometry (M). Quantitative data are means from three independent experiments.

Article Snippet: Complementary oligonucleotides containing the human Keap1 single-guide RNA (sgRNA) target sequences (table S2) were annealed and cloned into the Bbs I site of pX330 (Addgene).

Techniques: Derivative Assay, RNA Sequencing, Expressing, Immunoprecipitation, Binding Assay

( A ) HEK293T cells expressing Myc-Keap1 or its indicated C3IR mutants together with HA-ubiquitin (Ub) and FLAG-Nrf2 were treated with 10 μM MG132 for 6 hours, lysed, and subjected to immunoprecipitation with antibodies to FLAG. Asterisks indicate nonubiquitylated forms of FLAG-Nrf2. ( B ) Median fluorescence intensity (MFI) determined by flow cytometry for EGFP-Nrf2 expressed in HEK293T cells together with FLAG-Keap1 or its C3IR mutants. Data are means; n = 4. **** P < 0.0001 versus WT. ( C ) MFI of EGFP-Nrf2 expressed together with FLAG-Keap1 or its C3IR mutants that were treated with 1 μM MLN4924 for 24 hours before washout of MLN4924 and incubation of the cells with cycloheximide (CHX; 50 μg/ml) for the indicated times. Data are expressed relative to the value for time 0. ( D to F ) MFI of EGFP-Nrf2 expressed together with FLAG-Keap1 or its C3IR mutants during exposure to 25 μM tBHQ (D), 100 μM genistein (E), or 400 nM doxorubicin (F). ( G ) WT or Keap1 C3IR mutation knock-in HEK293T cells were exposed to 25 μM tBHQ, lysed, and subjected to immunoblot analysis with antibodies to Nrf2 (left). The relative abundance of endogenous Nrf2 was also quantitated (right). Data are means ± SEM; n = 5. ( H and I ) RT and real-time PCR analysis of HO1 (H) and NQO1 (I) mRNA abundance in WT or Keap1 C3IR mutation knock-in cells at 8 hours after treatment with 25 μM tBHQ. Data are means; n = 5. NS, not significant. ( J and K ) Flow cytometric analysis of WT or Keap1 C3IR mutation knock-in cells that were negative for annexin V and propidium iodide (PI) staining after treatment with 0.003% H 2 O 2 (J) or 5 μM doxorubicin (K) for 24 hours. Data are means; n = 5.

Journal: Science Advances

Article Title: Molecular evolution of Keap1 was essential for adaptation of vertebrates to terrestrial life

doi: 10.1126/sciadv.adg2379

Figure Lengend Snippet: ( A ) HEK293T cells expressing Myc-Keap1 or its indicated C3IR mutants together with HA-ubiquitin (Ub) and FLAG-Nrf2 were treated with 10 μM MG132 for 6 hours, lysed, and subjected to immunoprecipitation with antibodies to FLAG. Asterisks indicate nonubiquitylated forms of FLAG-Nrf2. ( B ) Median fluorescence intensity (MFI) determined by flow cytometry for EGFP-Nrf2 expressed in HEK293T cells together with FLAG-Keap1 or its C3IR mutants. Data are means; n = 4. **** P < 0.0001 versus WT. ( C ) MFI of EGFP-Nrf2 expressed together with FLAG-Keap1 or its C3IR mutants that were treated with 1 μM MLN4924 for 24 hours before washout of MLN4924 and incubation of the cells with cycloheximide (CHX; 50 μg/ml) for the indicated times. Data are expressed relative to the value for time 0. ( D to F ) MFI of EGFP-Nrf2 expressed together with FLAG-Keap1 or its C3IR mutants during exposure to 25 μM tBHQ (D), 100 μM genistein (E), or 400 nM doxorubicin (F). ( G ) WT or Keap1 C3IR mutation knock-in HEK293T cells were exposed to 25 μM tBHQ, lysed, and subjected to immunoblot analysis with antibodies to Nrf2 (left). The relative abundance of endogenous Nrf2 was also quantitated (right). Data are means ± SEM; n = 5. ( H and I ) RT and real-time PCR analysis of HO1 (H) and NQO1 (I) mRNA abundance in WT or Keap1 C3IR mutation knock-in cells at 8 hours after treatment with 25 μM tBHQ. Data are means; n = 5. NS, not significant. ( J and K ) Flow cytometric analysis of WT or Keap1 C3IR mutation knock-in cells that were negative for annexin V and propidium iodide (PI) staining after treatment with 0.003% H 2 O 2 (J) or 5 μM doxorubicin (K) for 24 hours. Data are means; n = 5.

Article Snippet: Complementary oligonucleotides containing the human Keap1 single-guide RNA (sgRNA) target sequences (table S2) were annealed and cloned into the Bbs I site of pX330 (Addgene).

Techniques: Expressing, Ubiquitin Proteomics, Immunoprecipitation, Fluorescence, Flow Cytometry, Incubation, Mutagenesis, Knock-In, Western Blot, Real-time Polymerase Chain Reaction, Staining

( A ) Schematic representation of exon 2 of the WT mouse Keap1 allele, the ssODN, and the W→A (replacement of C3IR of the mouse protein with that of zKeap1A) mutant allele after homologous recombination. The sgRNA and its protospacer adjacent motif are indicated by continuous and dotted overlines, respectively. The 5′ untranslated region and open reading frame of Keap1 are represented by the light and dark gray boxes, respectively. The mutation is shown in red. ( B ) GSEA plot performed for a gene set consisting of Nrf2 target genes with RNA-seq data obtained from the liver of 8-week-old Keap1 W→A/W→A and WT mice. NES, normalized enrichment score. ( C ) GO analysis of core enrichment genes in (B). The size of the bubbles indicates the number of genes enriched in the corresponding GO term, and their color represents the E ratio . ( D ) Experimental plan for assessment of liver injury induced by an overdose of APAP. ( E and F ) Representative hematoxylin and eosin staining of liver sections from APAP-treated Keap1 W→A/W→A or WT mice (E). The area of necrosis in such sections was quantified with ImageJ/Fiji (F). Quantitative data are means from eight or nine mice of each genotype. ( G ) Representative TUNEL staining for the liver of APAP-treated Keap1 W→A/W→A or WT mice. ( H to J ) Serum cholesterol ester/total cholesterol ratio (H) as well as AST (I) and ALT (J) activities for APAP-treated WT, Keap1 WT/W→A , or Keap1 W→A/W→A mice. Data are means for 8 or 10 mice of each genotype. ( K ) GSH/GSSG ratio for the liver of APAP-treated WT, Keap1 WT/W→A , or Keap1 W→A/W→A mice. Data are means for 8 or 10 mice of each genotype. ( L ) Immunohistochemical staining of 4-HNE in liver sections from APAP-treated Keap1 W→A/W→A or WT mice. Scale bars, 100 μm.

Journal: Science Advances

Article Title: Molecular evolution of Keap1 was essential for adaptation of vertebrates to terrestrial life

doi: 10.1126/sciadv.adg2379

Figure Lengend Snippet: ( A ) Schematic representation of exon 2 of the WT mouse Keap1 allele, the ssODN, and the W→A (replacement of C3IR of the mouse protein with that of zKeap1A) mutant allele after homologous recombination. The sgRNA and its protospacer adjacent motif are indicated by continuous and dotted overlines, respectively. The 5′ untranslated region and open reading frame of Keap1 are represented by the light and dark gray boxes, respectively. The mutation is shown in red. ( B ) GSEA plot performed for a gene set consisting of Nrf2 target genes with RNA-seq data obtained from the liver of 8-week-old Keap1 W→A/W→A and WT mice. NES, normalized enrichment score. ( C ) GO analysis of core enrichment genes in (B). The size of the bubbles indicates the number of genes enriched in the corresponding GO term, and their color represents the E ratio . ( D ) Experimental plan for assessment of liver injury induced by an overdose of APAP. ( E and F ) Representative hematoxylin and eosin staining of liver sections from APAP-treated Keap1 W→A/W→A or WT mice (E). The area of necrosis in such sections was quantified with ImageJ/Fiji (F). Quantitative data are means from eight or nine mice of each genotype. ( G ) Representative TUNEL staining for the liver of APAP-treated Keap1 W→A/W→A or WT mice. ( H to J ) Serum cholesterol ester/total cholesterol ratio (H) as well as AST (I) and ALT (J) activities for APAP-treated WT, Keap1 WT/W→A , or Keap1 W→A/W→A mice. Data are means for 8 or 10 mice of each genotype. ( K ) GSH/GSSG ratio for the liver of APAP-treated WT, Keap1 WT/W→A , or Keap1 W→A/W→A mice. Data are means for 8 or 10 mice of each genotype. ( L ) Immunohistochemical staining of 4-HNE in liver sections from APAP-treated Keap1 W→A/W→A or WT mice. Scale bars, 100 μm.

Article Snippet: Complementary oligonucleotides containing the human Keap1 single-guide RNA (sgRNA) target sequences (table S2) were annealed and cloned into the Bbs I site of pX330 (Addgene).

Techniques: Mutagenesis, Homologous Recombination, RNA Sequencing, Staining, TUNEL Assay, Immunohistochemical staining

( A ) The mouse fetus is protected from oxidative stress in the womb but is exposed to high ROS levels after birth as a result of the high ambient oxygen concentration and UV in sunlight. ( B ) Kaplan-Meier survival curves for WT, Keap1 WT/W→A , and Keap1 W→A/W→A mice exposed to UV-A/B radiation. ( C ) Concentration of MDA in urine of indicated mice that had been subjected (or not) to UV-A/B irradiation. Data are means for 8 to 14 mice of each genotype. ( D ) Concentration of MDA in skin of indicated mice that had been subjected to UV-A/B irradiation. Data are means for 10 to 12 mice of each genotype. ( E and F ) GSEA plots for gene sets associated with the response to oxidized phospholipids (E) or the inflammatory response (F) that were constructed from RNA-seq data for skin of Keap1 W→A/W→A and WT mice that had been exposed to UV-A/B radiation. ( G ) Concentration of MDA in lung of indicated mice that had been subjected to UV-A/B irradiation. Data are means for 10 to 12 mice of each genotype. ( H ) Volcano plot for RNA-seq data from lung of Keap1 W→A/W→A and WT mice that had been exposed to UV-A/B radiation. ( I ) GO analysis of differentially expressed genes up-regulated in Keap1 W→A/W→A mouse lung in (H). ( J ) Heatmap of differentially expressed genes in the gene set related to the inflammatory response (F) that was constructed from the RNA-seq data for lung tissue in (H) as well as for that of mice not subjected to UV irradiation. ( K ) Proportion of monocyte-derived M1 macrophages in lung of indicated mice that had been subjected to UV-A/B irradiation. Data are means for 5 to 27 mice of each genotype.

Journal: Science Advances

Article Title: Molecular evolution of Keap1 was essential for adaptation of vertebrates to terrestrial life

doi: 10.1126/sciadv.adg2379

Figure Lengend Snippet: ( A ) The mouse fetus is protected from oxidative stress in the womb but is exposed to high ROS levels after birth as a result of the high ambient oxygen concentration and UV in sunlight. ( B ) Kaplan-Meier survival curves for WT, Keap1 WT/W→A , and Keap1 W→A/W→A mice exposed to UV-A/B radiation. ( C ) Concentration of MDA in urine of indicated mice that had been subjected (or not) to UV-A/B irradiation. Data are means for 8 to 14 mice of each genotype. ( D ) Concentration of MDA in skin of indicated mice that had been subjected to UV-A/B irradiation. Data are means for 10 to 12 mice of each genotype. ( E and F ) GSEA plots for gene sets associated with the response to oxidized phospholipids (E) or the inflammatory response (F) that were constructed from RNA-seq data for skin of Keap1 W→A/W→A and WT mice that had been exposed to UV-A/B radiation. ( G ) Concentration of MDA in lung of indicated mice that had been subjected to UV-A/B irradiation. Data are means for 10 to 12 mice of each genotype. ( H ) Volcano plot for RNA-seq data from lung of Keap1 W→A/W→A and WT mice that had been exposed to UV-A/B radiation. ( I ) GO analysis of differentially expressed genes up-regulated in Keap1 W→A/W→A mouse lung in (H). ( J ) Heatmap of differentially expressed genes in the gene set related to the inflammatory response (F) that was constructed from the RNA-seq data for lung tissue in (H) as well as for that of mice not subjected to UV irradiation. ( K ) Proportion of monocyte-derived M1 macrophages in lung of indicated mice that had been subjected to UV-A/B irradiation. Data are means for 5 to 27 mice of each genotype.

Article Snippet: Complementary oligonucleotides containing the human Keap1 single-guide RNA (sgRNA) target sequences (table S2) were annealed and cloned into the Bbs I site of pX330 (Addgene).

Techniques: Concentration Assay, Irradiation, Construct, RNA Sequencing, Derivative Assay

S1P is required for hantavirus infection. (A) The S1P gene was knocked out in U2OS cells by using the CRISPR/Cas9 system. (Top) WT S1P gene sequence aligned with the sequences of both of the alleles in the S1P knockout (S1P-#1) cell clone. The gRNA target sequence is marked in red. The protospacer-adjacent motif (PAM) sequence of the gRNA target site is underlined. (Lower left) RT-PCR results for WT and S1P knockout (S1P-#1) cells using gRNA target site-specific primers. Human NPC1-specific primers were used as a control. (Lower right) S1P protein expression by anti-Flag immunostaining in S1P-#1 cells stably expressing Flag-tagged S1P. (B) WT and S1P knockout (S1P-#1) and S1P-reconstituted (S1P knockout cells stably expressing Flag-tagged S1P) U2OS cells were exposed to the indicated rVSVs at a multiplicity of infection (MOI) of 0.1 to 0.2 IU per cell. Infected (eGFP-positive) cells were visualized by fluorescence microscopy at 12 to 16 h postinfection. (C, left) Infected cells from the experiment in panel B were enumerated and normalized to infection in WT cells ( n = 6; two independent experiments). (Right) WT, S1P knockout, and S1P-reconstituted cells were exposed to authentic ANDV at an MOI of 0.1 to 0.2 PFU per cell. Infection was scored at 72 h postinfection by enumerating viral-antigen-positive cells and was normalized to infection in WT U2OS cells.

Journal: mBio

Article Title: Haploid Genetic Screen Reveals a Profound and Direct Dependence on Cholesterol for Hantavirus Membrane Fusion

doi: 10.1128/mBio.00801-15

Figure Lengend Snippet: S1P is required for hantavirus infection. (A) The S1P gene was knocked out in U2OS cells by using the CRISPR/Cas9 system. (Top) WT S1P gene sequence aligned with the sequences of both of the alleles in the S1P knockout (S1P-#1) cell clone. The gRNA target sequence is marked in red. The protospacer-adjacent motif (PAM) sequence of the gRNA target site is underlined. (Lower left) RT-PCR results for WT and S1P knockout (S1P-#1) cells using gRNA target site-specific primers. Human NPC1-specific primers were used as a control. (Lower right) S1P protein expression by anti-Flag immunostaining in S1P-#1 cells stably expressing Flag-tagged S1P. (B) WT and S1P knockout (S1P-#1) and S1P-reconstituted (S1P knockout cells stably expressing Flag-tagged S1P) U2OS cells were exposed to the indicated rVSVs at a multiplicity of infection (MOI) of 0.1 to 0.2 IU per cell. Infected (eGFP-positive) cells were visualized by fluorescence microscopy at 12 to 16 h postinfection. (C, left) Infected cells from the experiment in panel B were enumerated and normalized to infection in WT cells ( n = 6; two independent experiments). (Right) WT, S1P knockout, and S1P-reconstituted cells were exposed to authentic ANDV at an MOI of 0.1 to 0.2 PFU per cell. Infection was scored at 72 h postinfection by enumerating viral-antigen-positive cells and was normalized to infection in WT U2OS cells.

Article Snippet: A CRISPR guide RNA (gRNA) to target 1,716 to 1,738 nucleotides (target sequence 5′ GGTGCTGGCGTGCGGGGTTCTGG 3′) located in exon 10 of the S1P mRNA was cloned in the gRNA cloning vector (Addgene plasmid 41824) and used to generate the knockout cell line.

Techniques: Infection, CRISPR, Sequencing, Knock-Out, Reverse Transcription Polymerase Chain Reaction, Control, Expressing, Immunostaining, Stable Transfection, Fluorescence, Microscopy

( a ) Gene set enrichment plot showing that genes associated with high H3K9ac and H3K27ac are enriched for two independently defined pluripotency gene sets: Muller Plurinet (genes involved in the protein-protein network shared by diverse pluripotent cell types ) and Wong ESC Core (genes coordinately upregulated in mouse and human ESCs ). Data are derived from a single ChIP-Seq experiment . P values are calculated based on 1000 permutations by the GSEA algorithm and was not adjusted for multiple comparisons. ( b ) 2i increases acetylation at key pluripotency genes. H3K27ac (left) and H3K9ac (right) at enhancer (enh) or promoters of indicated genes as assessed by ChIP-qPCR. ( c ) ChIP-seq meta profile for Brd4 binding in ESCs cultured in S/L or S/L+2i. The metaprofile is centered on the midpoint of all Brd4 ChIP-seq peaks. ( d ) Brd4 ChIP-qPCR illustrating Brd4 binding in ESCs cultured in S/L (left) or S/L+2i (right) treated with DMSO (vehicle) or 500 nM JQ1 for 24 h. ( b,d ) Bars represent mean of n=3 technical replicates from one IP.

Journal: Nature cell biology

Article Title: Pluripotency transcription factors and Tet1/2 maintain Brd4-independent stem cell identity

doi: 10.1038/s41556-018-0086-3

Figure Lengend Snippet: ( a ) Gene set enrichment plot showing that genes associated with high H3K9ac and H3K27ac are enriched for two independently defined pluripotency gene sets: Muller Plurinet (genes involved in the protein-protein network shared by diverse pluripotent cell types ) and Wong ESC Core (genes coordinately upregulated in mouse and human ESCs ). Data are derived from a single ChIP-Seq experiment . P values are calculated based on 1000 permutations by the GSEA algorithm and was not adjusted for multiple comparisons. ( b ) 2i increases acetylation at key pluripotency genes. H3K27ac (left) and H3K9ac (right) at enhancer (enh) or promoters of indicated genes as assessed by ChIP-qPCR. ( c ) ChIP-seq meta profile for Brd4 binding in ESCs cultured in S/L or S/L+2i. The metaprofile is centered on the midpoint of all Brd4 ChIP-seq peaks. ( d ) Brd4 ChIP-qPCR illustrating Brd4 binding in ESCs cultured in S/L (left) or S/L+2i (right) treated with DMSO (vehicle) or 500 nM JQ1 for 24 h. ( b,d ) Bars represent mean of n=3 technical replicates from one IP.

Article Snippet: Previously described guide RNA (gRNA) sequences targeting Brd4 or a nongenic region on mouse chromosome 8 (ch8) were cloned into the pCas9 (BB)2A-GFP (pX458, Addgene plasmid number Plasmid #48138), as previously described .

Techniques: Derivative Assay, ChIP-sequencing, ChIP-qPCR, Binding Assay, Cell Culture

( a ) Quantification of colony formation assay of cells cultured in S/L (left) or S/L+2i (right) transfected with Cas9 and the indicated sgRNA against a nongenic region of chromosome 8 (ch8, control) or exon 3 (ex3) or exon 4 (ex4) of Brd4 . Dotted line represents average of ch8 controls. Each bar represents quantification of a single well of a six-well plate; transfected samples were seeded in duplicate. ( b ) Alkaline phosphatase staining of colonies formed from single cells of clonal ESC lines edited with sgRNA against chromosome 8 (ch8) or Brd4 exon 3 and cultured in S/L or S/L+2i. One representative well of a six-well plate is shown. ( c ) Quantification of colony formation assay shown in ( b ). ( d ) Western blot depicting Brd4 levels in ESCs expressing doxycycline (dox)-inducible hairpins against Renilla (shRen) or Brd4 (shBrd4). Cells were cultured with or without dox for 48 h prior to harvest. Actin is used as a loading control. Western blot was performed two independent times. ( e ) Brightfield images of ESCs expressing shBrd4-2 cultured for 48 h with or without doxycycline (dox). ( f ) Population doublings of cells cultured for 72 h in doxycycline relative to controls grown without dox. ( g ) Alkaline phosphatase staining of colonies formed from single cells expressing the indicated hairpins grown in the presence or absence of doxycycline (dox) and cultured in S/L or S/L+2i. One representative well of a six-well plate is shown. All bars represent mean ±SEM ( c ) or ±SD ( f ) of n=3 independent samples. ****, P < 0.0001 by 2-way ANOVA with Sidak’s multiple comparisons post test (shBrd4-1, P = 7.2e-10; shBrd4-2, P = 4.6e-8). Scale bar, 100 μm.

Journal: Nature cell biology

Article Title: Pluripotency transcription factors and Tet1/2 maintain Brd4-independent stem cell identity

doi: 10.1038/s41556-018-0086-3

Figure Lengend Snippet: ( a ) Quantification of colony formation assay of cells cultured in S/L (left) or S/L+2i (right) transfected with Cas9 and the indicated sgRNA against a nongenic region of chromosome 8 (ch8, control) or exon 3 (ex3) or exon 4 (ex4) of Brd4 . Dotted line represents average of ch8 controls. Each bar represents quantification of a single well of a six-well plate; transfected samples were seeded in duplicate. ( b ) Alkaline phosphatase staining of colonies formed from single cells of clonal ESC lines edited with sgRNA against chromosome 8 (ch8) or Brd4 exon 3 and cultured in S/L or S/L+2i. One representative well of a six-well plate is shown. ( c ) Quantification of colony formation assay shown in ( b ). ( d ) Western blot depicting Brd4 levels in ESCs expressing doxycycline (dox)-inducible hairpins against Renilla (shRen) or Brd4 (shBrd4). Cells were cultured with or without dox for 48 h prior to harvest. Actin is used as a loading control. Western blot was performed two independent times. ( e ) Brightfield images of ESCs expressing shBrd4-2 cultured for 48 h with or without doxycycline (dox). ( f ) Population doublings of cells cultured for 72 h in doxycycline relative to controls grown without dox. ( g ) Alkaline phosphatase staining of colonies formed from single cells expressing the indicated hairpins grown in the presence or absence of doxycycline (dox) and cultured in S/L or S/L+2i. One representative well of a six-well plate is shown. All bars represent mean ±SEM ( c ) or ±SD ( f ) of n=3 independent samples. ****, P < 0.0001 by 2-way ANOVA with Sidak’s multiple comparisons post test (shBrd4-1, P = 7.2e-10; shBrd4-2, P = 4.6e-8). Scale bar, 100 μm.

Article Snippet: Previously described guide RNA (gRNA) sequences targeting Brd4 or a nongenic region on mouse chromosome 8 (ch8) were cloned into the pCas9 (BB)2A-GFP (pX458, Addgene plasmid number Plasmid #48138), as previously described .

Techniques: Colony Assay, Cell Culture, Transfection, Control, Staining, Western Blot, Expressing

( a ) qRT-PCR on key pluripotency genes in ESCs cultured in S/L or S/L+2i treated with DMSO (veh) or 500 nM JQ1 for 24h. ( b ) qRT-PCR on key pluripotency genes in S/L or S/L+2i-cultured ESCs expressing dox-inducible hairpins against Renilla (shRen) or Brd4 (shBrd4) and treated with dox for 48 h. Shown are levels of Nanog and Esrrb in cells with dox relative to control S/L+shRen cells without dox. ( c ) Heat map shows expression of pluripotency associated genes measured by RNA-Seq in ESCs cultured in S/L or S/L+2i with vehicle (veh, DMSO) or 500 nM JQ1 for 72 h. Color scale represents Log 2 relative to mean expression level. ( d ) Nanog binding to key pluripotency loci in ESCs cultured in S/L or S/L+2i treated with DMSO or 500 nM JQ1 for 24h, assessed by ChIP-qPCR. Bar represents mean of n=3 technical replicates from one IP. ( e ) ATAC-Seq meta profile of chromatin accessibility in ESCs cultured in S/L (left) or S/L+2i (right) with DMSO or 500 nM JQ1. Data from 2 independent replicates are shown. ( f ) At baseline, 82% of Oct4, Sox2, Nanog (OSN) binding sites have an ATAC-Seq peak above background. OSN sites make up 60% (4,250/7,084) of the peaks that maintain accessibility despite JQ1 treatment in S/L+2i cultured ESCs but only 17% (93/545) of peaks lost in both conditions. ( g ) ChIP-seq meta profile for Med1 binding in ESCs cultured in S/L or S/L+2i treated 500 nM JQ1. ( h ) Box plot shows relative Med1 binding at n=635 genes that are downregulated > 2 fold, FDR < 5% by JQ1 in ESCs cultured in S/L but not in ESCs cultured in S/L+2i. Values from ChIP-Seq experiment shown in (g) with 1 ChIP per condition. Box, 25-75 th percentile; bar, median; whiskers, 5-95 th percentile. ****, P < 1e-15; ns, P = 0.27 by 2-way ANOVA with Tukey’s multiple comparisons post test. See . ( i ) Sites that gain Med1 binding in S/L+2i+JQ1 relative to S/L+JQ1 are mostly OSN binding sites. Data presented as mean ± SD of n=3 independent samples ( a , b ).

Journal: Nature cell biology

Article Title: Pluripotency transcription factors and Tet1/2 maintain Brd4-independent stem cell identity

doi: 10.1038/s41556-018-0086-3

Figure Lengend Snippet: ( a ) qRT-PCR on key pluripotency genes in ESCs cultured in S/L or S/L+2i treated with DMSO (veh) or 500 nM JQ1 for 24h. ( b ) qRT-PCR on key pluripotency genes in S/L or S/L+2i-cultured ESCs expressing dox-inducible hairpins against Renilla (shRen) or Brd4 (shBrd4) and treated with dox for 48 h. Shown are levels of Nanog and Esrrb in cells with dox relative to control S/L+shRen cells without dox. ( c ) Heat map shows expression of pluripotency associated genes measured by RNA-Seq in ESCs cultured in S/L or S/L+2i with vehicle (veh, DMSO) or 500 nM JQ1 for 72 h. Color scale represents Log 2 relative to mean expression level. ( d ) Nanog binding to key pluripotency loci in ESCs cultured in S/L or S/L+2i treated with DMSO or 500 nM JQ1 for 24h, assessed by ChIP-qPCR. Bar represents mean of n=3 technical replicates from one IP. ( e ) ATAC-Seq meta profile of chromatin accessibility in ESCs cultured in S/L (left) or S/L+2i (right) with DMSO or 500 nM JQ1. Data from 2 independent replicates are shown. ( f ) At baseline, 82% of Oct4, Sox2, Nanog (OSN) binding sites have an ATAC-Seq peak above background. OSN sites make up 60% (4,250/7,084) of the peaks that maintain accessibility despite JQ1 treatment in S/L+2i cultured ESCs but only 17% (93/545) of peaks lost in both conditions. ( g ) ChIP-seq meta profile for Med1 binding in ESCs cultured in S/L or S/L+2i treated 500 nM JQ1. ( h ) Box plot shows relative Med1 binding at n=635 genes that are downregulated > 2 fold, FDR < 5% by JQ1 in ESCs cultured in S/L but not in ESCs cultured in S/L+2i. Values from ChIP-Seq experiment shown in (g) with 1 ChIP per condition. Box, 25-75 th percentile; bar, median; whiskers, 5-95 th percentile. ****, P < 1e-15; ns, P = 0.27 by 2-way ANOVA with Tukey’s multiple comparisons post test. See . ( i ) Sites that gain Med1 binding in S/L+2i+JQ1 relative to S/L+JQ1 are mostly OSN binding sites. Data presented as mean ± SD of n=3 independent samples ( a , b ).

Article Snippet: Previously described guide RNA (gRNA) sequences targeting Brd4 or a nongenic region on mouse chromosome 8 (ch8) were cloned into the pCas9 (BB)2A-GFP (pX458, Addgene plasmid number Plasmid #48138), as previously described .

Techniques: Quantitative RT-PCR, Cell Culture, Expressing, Control, RNA Sequencing, Binding Assay, ChIP-qPCR, ChIP-sequencing

Talin binding to the β7 cytoplasmic domain activates integrin α4β7. (A) Expression of talin and β7 in parental or talin KO β7-expressing Jurkat T cells. Top: Total expression by Western blot. Bottom: Surface expression by flow cytometry. The filled histograms represent untransfected Jurkat cells, whereas open histograms represent β7-expressing Jurkat cells or talin KO cells. (B) Binding of soluble MAdCAM-1 to β7 expressing Jurkat T cells or talin KO cells. PMA (100 nM) markedly increased binding to parental but not talin KO cells. Mn 2+ (0.5 mM) stimulated binding to both cell types. Stimulated cells were compared with resting (None) for each cell line using one-way ANOVA. (C) Adhesion of β7-expressing Jurkat T cells or Jurkat-talin KO cells to MAdCAM-1 substrate in the presence or absence of PMA (100 nM) under a wall shear stress of 2 dyn/cm 2 . Nontransfected Jurkat T cells (Jurkat) provided a negative control. Jurkat-β7-Talin KO or Jurkat were compared with the Jurkat-β7 for each condition using one-way ANOVA. (D) Structural model of the talin F3 domain in complex with integrin β7 tail (Arg 728 to Thr 766 ). Talin F3 domain is shown by a surface representation and colored by charge. A ribbon diagram of the docked β7 tail is highlighted in red. β7-Leu 758 and -Tyr 759 in the NPLY motif are shown as light blue–colored stick figures. (E) Soluble MAdCAM-1 binding to 293T cells transfected with WT or mutant α4β7 with or without THD cotransfection. Mn 2+ (0.5 mM) was used as a positive control for integrin activation. Nontransfected 293T cells (MOCK) provided a negative control. Mutant integrins were compared with the WT for each condition using one-way ANOVA. (F) Adhesion of 293T cells transfected with WT or mutant α4β7 with or without THD cotransfection on MAdCAM-1 under a wall shear stress of 2 dyn/cm 2 . Nontransfected 293T cells (MOCK) provided a negative control. Mutant integrins were compared with the WT for each condition using one-way ANOVA. (G) Binding of soluble MAdCAM-1 to 293T-α4β7 cells transfected with EGFP vector, EGFP-THD, EGFP-THD(L325R), or EGFP-THD(W359A). THD-stimulated cells were compared with vector control (α4β7 + EGFP vector) for each cell line using two-way ANOVA. MFI, mean fluorescent intensity. (H) Adhesion of 293T-α4β7 cells transfected with EGFP vector, EGFP-THD, EGFP-THD(L325R), or EGFP-THD(W359A) on MAdCAM-1 under a wall shear stress of 2 dyn/cm 2 . 293T cells transfected with THD only and nontransfected 293T cells (MOCK) were used as negative controls. THD-stimulated cells were compared with vector control (α4β7 + EGFP vector) for each cell line using one-way ANOVA. Error bars show means ± SD. n = 5. NS, P > 0.05; *, 0.01 < P < 0.05; **, 0.001 < P < 0.01; ***, P < 0.001.

Journal: The Journal of Cell Biology

Article Title: Transmission of integrin β7 transmembrane domain topology enables gut lymphoid tissue development

doi: 10.1083/jcb.201707055

Figure Lengend Snippet: Talin binding to the β7 cytoplasmic domain activates integrin α4β7. (A) Expression of talin and β7 in parental or talin KO β7-expressing Jurkat T cells. Top: Total expression by Western blot. Bottom: Surface expression by flow cytometry. The filled histograms represent untransfected Jurkat cells, whereas open histograms represent β7-expressing Jurkat cells or talin KO cells. (B) Binding of soluble MAdCAM-1 to β7 expressing Jurkat T cells or talin KO cells. PMA (100 nM) markedly increased binding to parental but not talin KO cells. Mn 2+ (0.5 mM) stimulated binding to both cell types. Stimulated cells were compared with resting (None) for each cell line using one-way ANOVA. (C) Adhesion of β7-expressing Jurkat T cells or Jurkat-talin KO cells to MAdCAM-1 substrate in the presence or absence of PMA (100 nM) under a wall shear stress of 2 dyn/cm 2 . Nontransfected Jurkat T cells (Jurkat) provided a negative control. Jurkat-β7-Talin KO or Jurkat were compared with the Jurkat-β7 for each condition using one-way ANOVA. (D) Structural model of the talin F3 domain in complex with integrin β7 tail (Arg 728 to Thr 766 ). Talin F3 domain is shown by a surface representation and colored by charge. A ribbon diagram of the docked β7 tail is highlighted in red. β7-Leu 758 and -Tyr 759 in the NPLY motif are shown as light blue–colored stick figures. (E) Soluble MAdCAM-1 binding to 293T cells transfected with WT or mutant α4β7 with or without THD cotransfection. Mn 2+ (0.5 mM) was used as a positive control for integrin activation. Nontransfected 293T cells (MOCK) provided a negative control. Mutant integrins were compared with the WT for each condition using one-way ANOVA. (F) Adhesion of 293T cells transfected with WT or mutant α4β7 with or without THD cotransfection on MAdCAM-1 under a wall shear stress of 2 dyn/cm 2 . Nontransfected 293T cells (MOCK) provided a negative control. Mutant integrins were compared with the WT for each condition using one-way ANOVA. (G) Binding of soluble MAdCAM-1 to 293T-α4β7 cells transfected with EGFP vector, EGFP-THD, EGFP-THD(L325R), or EGFP-THD(W359A). THD-stimulated cells were compared with vector control (α4β7 + EGFP vector) for each cell line using two-way ANOVA. MFI, mean fluorescent intensity. (H) Adhesion of 293T-α4β7 cells transfected with EGFP vector, EGFP-THD, EGFP-THD(L325R), or EGFP-THD(W359A) on MAdCAM-1 under a wall shear stress of 2 dyn/cm 2 . 293T cells transfected with THD only and nontransfected 293T cells (MOCK) were used as negative controls. THD-stimulated cells were compared with vector control (α4β7 + EGFP vector) for each cell line using one-way ANOVA. Error bars show means ± SD. n = 5. NS, P > 0.05; *, 0.01 < P < 0.05; **, 0.001 < P < 0.01; ***, P < 0.001.

Article Snippet: Mouse β7 and human talin single guide RNAs (sgRNAs) were constructed in vector pSpCas9n(BB)-2A-Puro (48141; Addgene; ).

Techniques: Binding Assay, Expressing, Western Blot, Flow Cytometry, Shear, Negative Control, Transfection, Mutagenesis, Cotransfection, Positive Control, Activation Assay, Plasmid Preparation, Control

Blocking talin-induced change in β7 TMD topology abolished α4β7 activation. (A) Sequence alignment of partial TMDs of integrin β3 and β7 subunits. β3 Pro mutant site Ala 711 is highlighted in red. The sites in β7 that were mutated to Pro (Leu 721 and Leu 723 ) are highlighted in green and Gly 722 is highlighted in pink and are projected onto a homology model of the α4β7 TMD (α4 in blue and β7 in red). (B) Adhesion of 293T cells transfected with β7 WT or mutations (L721P, G722P, or L723P) plus α4 on MAdCAM-1 under a wall shear stress of 2 dyn/cm 2 . Nontransfected 293T cells (MOCK) were used as a negative control (Ctrl). Mutant integrins were compared with the WT using one-way ANOVA. (C) Binding of soluble MAdCAM-1 to 293T cells transfected with WT α4β7 or α4 in combination with mutants (L721P, G722P, and L723P) in the presence or absence of THD. Nontransfected 293T cells (MOCK) were used as a negative control. Mutant integrins were compared with the WT for each condition using one-way ANOVA. Error bars show means ± SD. n = 5 (A and B) or 4 (C). *, 0.01 < P < 0.05; **, 0.001 < P < 0.01; ***, P < 0.001. MFI, mean fluorescence intensity. (D) Coimmunoprecipitation of THD with α4β7 WT or mutants. Lysates of 293T cells were transfected as in C, in combination with THD-GFP, and α4β7 was isolated by immunoprecipitation (IP). Precipitated proteins were analyzed by Western blotting with the indicated antibodies and confirmed similar THD association with the mutant and WT integrins. Data are representative of at least three independent experiments. Note that a shorter exposure time was used for the THD input. Molecular masses are given in kilodaltons. (E) A model of how a Pro mutation can prevent transmission of altered topology of the β7 TMD by talin. The complex formed between the β7 cytoplasmic tail/TMD (red) and cytoplasmic talin F3 domain (surface representation; colored by charge) alters the topology of the inner portion of the transmembrane helix, which is transmitted to the outer moiety, where it can disrupt the outer membrane clasp , resulting in destabilization of the α-β TMD complex and integrin activation. β7(L721P) breaks the TMD helix into two helices connected by a flexible kink; the flexible kink prevents transmission of the talin-induced change in intracellular TMD topology to stabilize the α-β TMD interaction and block talin-induced activation of integrin α4β7.

Journal: The Journal of Cell Biology

Article Title: Transmission of integrin β7 transmembrane domain topology enables gut lymphoid tissue development

doi: 10.1083/jcb.201707055

Figure Lengend Snippet: Blocking talin-induced change in β7 TMD topology abolished α4β7 activation. (A) Sequence alignment of partial TMDs of integrin β3 and β7 subunits. β3 Pro mutant site Ala 711 is highlighted in red. The sites in β7 that were mutated to Pro (Leu 721 and Leu 723 ) are highlighted in green and Gly 722 is highlighted in pink and are projected onto a homology model of the α4β7 TMD (α4 in blue and β7 in red). (B) Adhesion of 293T cells transfected with β7 WT or mutations (L721P, G722P, or L723P) plus α4 on MAdCAM-1 under a wall shear stress of 2 dyn/cm 2 . Nontransfected 293T cells (MOCK) were used as a negative control (Ctrl). Mutant integrins were compared with the WT using one-way ANOVA. (C) Binding of soluble MAdCAM-1 to 293T cells transfected with WT α4β7 or α4 in combination with mutants (L721P, G722P, and L723P) in the presence or absence of THD. Nontransfected 293T cells (MOCK) were used as a negative control. Mutant integrins were compared with the WT for each condition using one-way ANOVA. Error bars show means ± SD. n = 5 (A and B) or 4 (C). *, 0.01 < P < 0.05; **, 0.001 < P < 0.01; ***, P < 0.001. MFI, mean fluorescence intensity. (D) Coimmunoprecipitation of THD with α4β7 WT or mutants. Lysates of 293T cells were transfected as in C, in combination with THD-GFP, and α4β7 was isolated by immunoprecipitation (IP). Precipitated proteins were analyzed by Western blotting with the indicated antibodies and confirmed similar THD association with the mutant and WT integrins. Data are representative of at least three independent experiments. Note that a shorter exposure time was used for the THD input. Molecular masses are given in kilodaltons. (E) A model of how a Pro mutation can prevent transmission of altered topology of the β7 TMD by talin. The complex formed between the β7 cytoplasmic tail/TMD (red) and cytoplasmic talin F3 domain (surface representation; colored by charge) alters the topology of the inner portion of the transmembrane helix, which is transmitted to the outer moiety, where it can disrupt the outer membrane clasp , resulting in destabilization of the α-β TMD complex and integrin activation. β7(L721P) breaks the TMD helix into two helices connected by a flexible kink; the flexible kink prevents transmission of the talin-induced change in intracellular TMD topology to stabilize the α-β TMD interaction and block talin-induced activation of integrin α4β7.

Article Snippet: Mouse β7 and human talin single guide RNAs (sgRNAs) were constructed in vector pSpCas9n(BB)-2A-Puro (48141; Addgene; ).

Techniques: Blocking Assay, Activation Assay, Sequencing, Mutagenesis, Transfection, Shear, Negative Control, Binding Assay, Fluorescence, Isolation, Immunoprecipitation, Western Blot, Transmission Assay, Membrane

Inhibiting talin-induced change in β7 TMD topology impairs agonist-induced α4β7 activation. (A) Binding of soluble MAdCAM-1 to Jurkat T cells stably expressing WT or mutant β7(L721P or L723P) with or without CXCL12 or PMA stimulation. Mutant integrins were compared with the WT for each condition using one-way ANOVA. Error bars show means ± SD. n = 5. NS, P > 0.05; **, 0.001 < P < 0.01; ***, P < 0.001. MFI, mean fluorescence intensity. (B) β7 cell surface expression on Jurkat T cells stably expressing WT or mutant β7(L721P or L723P). Mock-transfected cells are depicted in the filled histograms. (C) α4β7 was immunoprecipitated (IP) from lysates of CXCL12-stimulated cells or unstimulated cells depicted in A, and bound proteins were analyzed by Western blotting with the indicated antibodies. Data are representative of at least three independent experiments. Molecular masses are given in kilodaltons.

Journal: The Journal of Cell Biology

Article Title: Transmission of integrin β7 transmembrane domain topology enables gut lymphoid tissue development

doi: 10.1083/jcb.201707055

Figure Lengend Snippet: Inhibiting talin-induced change in β7 TMD topology impairs agonist-induced α4β7 activation. (A) Binding of soluble MAdCAM-1 to Jurkat T cells stably expressing WT or mutant β7(L721P or L723P) with or without CXCL12 or PMA stimulation. Mutant integrins were compared with the WT for each condition using one-way ANOVA. Error bars show means ± SD. n = 5. NS, P > 0.05; **, 0.001 < P < 0.01; ***, P < 0.001. MFI, mean fluorescence intensity. (B) β7 cell surface expression on Jurkat T cells stably expressing WT or mutant β7(L721P or L723P). Mock-transfected cells are depicted in the filled histograms. (C) α4β7 was immunoprecipitated (IP) from lysates of CXCL12-stimulated cells or unstimulated cells depicted in A, and bound proteins were analyzed by Western blotting with the indicated antibodies. Data are representative of at least three independent experiments. Molecular masses are given in kilodaltons.

Article Snippet: Mouse β7 and human talin single guide RNAs (sgRNAs) were constructed in vector pSpCas9n(BB)-2A-Puro (48141; Addgene; ).

Techniques: Activation Assay, Binding Assay, Stable Transfection, Expressing, Mutagenesis, Fluorescence, Transfection, Immunoprecipitation, Western Blot

Suppressing talin-induced change in β7 TMD topology perturbed mouse lymphocyte homing to the gut. (A) Cell surface expression of α4β7 in TK1-β7 KO cells stably expressing WT β7 or mutant β7(L721P). (B) Binding of soluble mouse MAdCAM-1 to the cells shown in A with or without CXCL12 stimulation. The TK1-β7 KO cell was used as a negative control. Stimulated cells were compared with resting (None) for each cell line using one-way ANOVA. MFI, mean fluorescence intensity. (C and D) In vivo competitive homing of TK1-β7 KO cells that stably express WT β7(β7 WT) or proline mutant β7(β7[L721P]) to different lymphoid tissues. TK1-β7 WT or TK1-β7(L721P) cells were labeled with eFluor 670. TK1 parental (TK1) cells were labeled with CFSE as an input control. Equal numbers (2 × 10 7 ) of eFluor 670–labeled cells and CFSE-labeled cells were mixed and then intravenously injected into C57BL/6J mice. Lymphoid organs were isolated 2 h after injection. The eFluor 670– or CFSE-labeled cells that homed into different lymphoid organs were enumerated by flow cytometry. The total numbers of homed cells to different lymphoid organs are shown in C. MLN (per mouse), PP (per mouse), PLN (per lymph node), and SP (per mouse). The ratio of TK1 parental cells to TK1-KO cells reconstituted with β7 WT or β7(L721P) cells recovered from different lymphoid organs is shown in D. Error bars show means ± SD. n = 5 (A and B) or 24 (C and D). NS, P > 0.05; **, 0.001 < P < 0.01; ***, P < 0.001.

Journal: The Journal of Cell Biology

Article Title: Transmission of integrin β7 transmembrane domain topology enables gut lymphoid tissue development

doi: 10.1083/jcb.201707055

Figure Lengend Snippet: Suppressing talin-induced change in β7 TMD topology perturbed mouse lymphocyte homing to the gut. (A) Cell surface expression of α4β7 in TK1-β7 KO cells stably expressing WT β7 or mutant β7(L721P). (B) Binding of soluble mouse MAdCAM-1 to the cells shown in A with or without CXCL12 stimulation. The TK1-β7 KO cell was used as a negative control. Stimulated cells were compared with resting (None) for each cell line using one-way ANOVA. MFI, mean fluorescence intensity. (C and D) In vivo competitive homing of TK1-β7 KO cells that stably express WT β7(β7 WT) or proline mutant β7(β7[L721P]) to different lymphoid tissues. TK1-β7 WT or TK1-β7(L721P) cells were labeled with eFluor 670. TK1 parental (TK1) cells were labeled with CFSE as an input control. Equal numbers (2 × 10 7 ) of eFluor 670–labeled cells and CFSE-labeled cells were mixed and then intravenously injected into C57BL/6J mice. Lymphoid organs were isolated 2 h after injection. The eFluor 670– or CFSE-labeled cells that homed into different lymphoid organs were enumerated by flow cytometry. The total numbers of homed cells to different lymphoid organs are shown in C. MLN (per mouse), PP (per mouse), PLN (per lymph node), and SP (per mouse). The ratio of TK1 parental cells to TK1-KO cells reconstituted with β7 WT or β7(L721P) cells recovered from different lymphoid organs is shown in D. Error bars show means ± SD. n = 5 (A and B) or 24 (C and D). NS, P > 0.05; **, 0.001 < P < 0.01; ***, P < 0.001.

Article Snippet: Mouse β7 and human talin single guide RNAs (sgRNAs) were constructed in vector pSpCas9n(BB)-2A-Puro (48141; Addgene; ).

Techniques: Expressing, Stable Transfection, Mutagenesis, Binding Assay, Negative Control, Fluorescence, In Vivo, Labeling, Control, Injection, Isolation, Flow Cytometry

Disruption of GALT development in Itgb7 L720P/L720P mice. (A) Schematic of the Cas9/sgRNA-targeting sites in Itgb7 . The sgRNA-targeting sequences are underlined in blue, and the protospacer-adjacent motif (PAM) sequence is labeled in blue in the WT sequence. The MaeI restriction site removed from the WT and ApaI site introduced in the mutant are labeled as are the Leu codon changed to Pro. (B) Sequencing analysis of WT and β7(L720P) knock-in mice. DNA sequencing confirmed a leucine to proline substitution at position 720 of the mouse β7 integrin gene (position 721 in human β7 integrin gene). The mutation is labeled in red. The silent mutations are labeled in green and with green asterisks. (C) The absolute number of CD3 + T cells and B220 + B cells isolated from Itgb7 WT/WT mice and Itgb7 WT/L720P , or Itgb7 L720P/L720P littermates are shown. Error bars show means ± SD. n = 8. NS, P > 0.05; ***, P < 0.001.

Journal: The Journal of Cell Biology

Article Title: Transmission of integrin β7 transmembrane domain topology enables gut lymphoid tissue development

doi: 10.1083/jcb.201707055

Figure Lengend Snippet: Disruption of GALT development in Itgb7 L720P/L720P mice. (A) Schematic of the Cas9/sgRNA-targeting sites in Itgb7 . The sgRNA-targeting sequences are underlined in blue, and the protospacer-adjacent motif (PAM) sequence is labeled in blue in the WT sequence. The MaeI restriction site removed from the WT and ApaI site introduced in the mutant are labeled as are the Leu codon changed to Pro. (B) Sequencing analysis of WT and β7(L720P) knock-in mice. DNA sequencing confirmed a leucine to proline substitution at position 720 of the mouse β7 integrin gene (position 721 in human β7 integrin gene). The mutation is labeled in red. The silent mutations are labeled in green and with green asterisks. (C) The absolute number of CD3 + T cells and B220 + B cells isolated from Itgb7 WT/WT mice and Itgb7 WT/L720P , or Itgb7 L720P/L720P littermates are shown. Error bars show means ± SD. n = 8. NS, P > 0.05; ***, P < 0.001.

Article Snippet: Mouse β7 and human talin single guide RNAs (sgRNAs) were constructed in vector pSpCas9n(BB)-2A-Puro (48141; Addgene; ).

Techniques: Disruption, Sequencing, Labeling, Mutagenesis, Knock-In, DNA Sequencing, Isolation

Itgb7 L720P/L720P adult mice have reduced gut-tropic β7 high effector/activated T cells. (A) Equivalent cell surface expression of integrin αL, α4, β1, β2, and β7 and intracellular expression of kindlin 3 and talin in neonatal Itgb7 WT/WT mice and Itgb7 L720P/L720P littermates are shown. (B) Cell surface expression of β7 is reduced in 8-wk-old Itgb7 L720P/L720P compared with Itgb7 WT/WT littermates. (C) The ratio of cell surface expression of integrin β7 on effector/activated T cells (CD62L low CD44 high ) compared with naive T cells (CD62L high CD44 low ) in 8-wk-old Itgb7 WT/WT mice and Itgb7 L720P/L720P littermates. Mean fluorescence intensities are displayed on the representative histograms. Error bars show means ± SD. **, 0.001 < P < 0.01. Teff, effector T cells.

Journal: The Journal of Cell Biology

Article Title: Transmission of integrin β7 transmembrane domain topology enables gut lymphoid tissue development

doi: 10.1083/jcb.201707055

Figure Lengend Snippet: Itgb7 L720P/L720P adult mice have reduced gut-tropic β7 high effector/activated T cells. (A) Equivalent cell surface expression of integrin αL, α4, β1, β2, and β7 and intracellular expression of kindlin 3 and talin in neonatal Itgb7 WT/WT mice and Itgb7 L720P/L720P littermates are shown. (B) Cell surface expression of β7 is reduced in 8-wk-old Itgb7 L720P/L720P compared with Itgb7 WT/WT littermates. (C) The ratio of cell surface expression of integrin β7 on effector/activated T cells (CD62L low CD44 high ) compared with naive T cells (CD62L high CD44 low ) in 8-wk-old Itgb7 WT/WT mice and Itgb7 L720P/L720P littermates. Mean fluorescence intensities are displayed on the representative histograms. Error bars show means ± SD. **, 0.001 < P < 0.01. Teff, effector T cells.

Article Snippet: Mouse β7 and human talin single guide RNAs (sgRNAs) were constructed in vector pSpCas9n(BB)-2A-Puro (48141; Addgene; ).

Techniques: Expressing, Fluorescence